Bd Sars Test Kits

Lab Reagents

Human IgG antibody Laboratories manufactures the bd sars test kits reagents distributed by Genprice. The Bd Sars Test Kits reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Bd products are available in stock. Specificity: Bd Category: Sars Group: Test Kits

Test Kits information

Necrosis vs Apoptosis Kits

KF17372 100-200 Tests
EUR 768

Pipette Stand Starter Kits

P7700-S1 1 PC
EUR 507.83
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Pipette Stand Starter Kits

P7700-S2 1 PC
EUR 526.1
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

BD-2 Antibody

5372-100
EUR 338

OXF BD 02

B4918-10 10 mg
EUR 350

OXF BD 02

B4918-50 50 mg
EUR 1314

BD 1047 dihydrobromide

B1069-10
EUR 175

BD 1047 dihydrobromide

B1069-50
EUR 544

BD 1008 dihydrobromide

B6330-10 10 mg
EUR 189
Description: BD 1008 dihydrobromide is a potent and selective ligand for ?-receptor with Ki values of 2 and 8 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2 [2].

BD 1008 dihydrobromide

B6330-5 5 mg
EUR 134
Description: BD 1008 dihydrobromide is a potent and selective ligand for ?-receptor with Ki values of 2 and 8 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2 [2].

BD 1008 dihydrobromide

B6330-50 50 mg
EUR 676
Description: BD 1008 dihydrobromide is a potent and selective ligand for ?-receptor with Ki values of 2 and 8 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2 [2].

BD 1063 dihydrochloride

B6489-10 10 mg
EUR 171
Description: BD 1063 dihydrochloride is an antagonist of ?-1 receptor with Ki value of 9.15 nM [1].?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.?-1 receptor plays an important role in stimulating dopamine release and modulating the actions of cocaine [2].

BD 1063 dihydrochloride

B6489-5 5 mg
EUR 126
Description: BD 1063 dihydrochloride is an antagonist of ?-1 receptor with Ki value of 9.15 nM [1].?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.?-1 receptor plays an important role in stimulating dopamine release and modulating the actions of cocaine [2].

Apoa5 (bd) Antibody

abx015771-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

BD 1047 dihydrobromide

B6521-10 10 mg
EUR 187
Description: BD 1047 dihydrobromide is an antagonist of ?1 receptor with Ki values of 0.93 and 47 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.

BD 1047 dihydrobromide

B6521-25 25 mg
EUR 355
Description: BD 1047 dihydrobromide is an antagonist of ?1 receptor with Ki values of 0.93 and 47 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.

BD 1047 dihydrobromide

B6521-5 5 mg
EUR 126
Description: BD 1047 dihydrobromide is an antagonist of ?1 receptor with Ki values of 0.93 and 47 nM for ?-1 receptor and ?-2 receptor, respectively [1]. ?-receptor is a type of opioid receptor. There are two subtypes of ?-receptor: ?-1 and ?-2.

BD-AcAc 2

HY-15344 100mg
EUR 641

BD-1047 (dihydrobromide)

HY-16996A 10mg
EUR 173

BD-1, Human

HY-P7133 50ug
EUR 612

BD-1, Rat

HY-P7134 50ug
EUR 612

BD-2, Human

HY-P7135 50ug
EUR 533

BD-2, Mouse

HY-P7136 50ug
EUR 533

BD-3, Human

HY-P7137 50ug
EUR 533

BD-3, Mouse

HY-P7138 10ug
EUR 268

BD-3, Rat

HY-P7139 10ug
EUR 268

BD-4, Human

HY-P7140 50ug
EUR 533

BD-4, Rat

HY-P7141 50ug
EUR 533

4L Uniscint BD

NAT1410 4L
EUR 204

20L Uniscint BD

NAT1412 20L
EUR 772

BD-1, rat

RC260-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-3, rat

RC260-14 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-4, rat

RC260-15 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

MitoPT™ TMRE & TMRM Kits

KF17358 500 Test
EUR 479

MitoPT™ TMRE & TMRM Kits

KF17359 500 Test
EUR 479

Rat Neural Stem Cell Kits

PC37123 1 X 10(6) *minimum order 6 vials*
EUR 957

HISTAR DETECTION SYSTEM Kits (OKSA11259)

OKSA11259 50 Tests
EUR 565
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

HISTAR DETECTION SYSTEM Kits (OKSA11260)

OKSA11260 150 Tests
EUR 1335
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

HISTAR DETECTION SYSTEM Kits (OKSA11261)

OKSA11261 500 Tests
EUR 2019
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

CellQuanti-Blue Cell Viability Assay Kits

CQBL-05K 5000
EUR 221
Description: Homogeneous assay for cell viability, proliferation, cytotoxcity, high-throµghput screening for anticancer agents. Fluorimetric method (530nm/590nm). Kit size: 5000 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

CellQuanti-Blue Cell Viability Assay Kits

CQBL-10K 10000
EUR 340
Description: Homogeneous assay for cell viability, proliferation, cytotoxcity, high-throµghput screening for anticancer agents. Fluorimetric method (530nm/590nm). Kit size: 10000 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

CellQuanti-MTT Cell Viability Assay Kits

CQMT-500 500
EUR 210
Description: Colorimetric (570nm) assay for cell viability, proliferation, cytotoxcity, HTS for anticancer agents. Kit size: 500 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4, -20°C.

MITOCHONDRIAL MEMBRANE POTENTIAL KIT Kits (OKSA11298)

OKSA11298 500 Tests
EUR 956
Description: Description of target: MITOCHONDRIAL MEMBRANE POTENTIAL KIT ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

MITOCHONDRIAL MEMBRANE POTENTIAL KIT Kits (OKSA11300)

OKSA11300 500 Tests
EUR 956
Description: Description of target: MITOCHONDRIAL MEMBRANE POTENTIAL KIT ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

BD-1, human recombinant

4506-1000
EUR 3258

BD-1, human recombinant

4506-20
EUR 256

BD-3, human recombinant

4524-1000
EUR 3203

BD-3, human recombinant

4524-20
EUR 245

BD-4, human recombinant

4525-1000
EUR 3203

BD-4, human recombinant

4525-20
EUR 256

BD-2, human recombinant

4372-1000
EUR 3856

BD-2, human recombinant

4372-20
EUR 245

BD-1, murine (mouse)

RC230-12 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-3, murine (mouse)

RC230-14 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Defensins

BD-2, murine (mouse)

RC240-13 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Defensins

NATtrol BV Negative Control (6 X 0.15mL)

NATBVNEG-BD 6 X 0.15mL
EUR 288.16
  • What is the product classification?
  • NATtrol BV Negative Control is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol BV Positive Control (6 X 0.15mL)

NATBVPOS-BD 6 X 0.15mL
EUR 407.76
  • What is the product classification?
  • NATtrol BV Positive Control is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Candida/TV Positive Control (ea)

NATCTVPOS-BD ea
EUR 407.76
  • What is the product classification?
  • NATtrol Candida/TV Positive Control is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Vaginal Panel (24 x 0.5 mL)

NATVP-BD 24 x 0.5 mL
EUR 1003.68
  • What is the product classification?
  • NATtrol Vaginal Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

anti-Apoa5 (bd) (4H8H8E2 (c))

LF-MA30003 100 ul
EUR 577
Description: Mouse Monoclonal to Apoa5 (bd)

Recombinant Human BD-3 Protein

PROTP81534-1 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-3 is a 5.1 kDa protein containing 45 amino acid residues.

Recombinant Human BD-4 Protein

PROTQ8WTQ1-1 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces.  In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells.  The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds.   BD-4 is expressed in testis, stomach, uterus, neutrophils, thyroid, lung and kidney.  In addition to its direct antimicrobial activities, BD-4 is chemoattractant towards human blood monocytes.  Recombinant human BD-4 is a 6.0 kDa protein containing 50 amino acid residues.

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Anti-ApoA-V(bd) antibody

STJ97837 100 µl
EUR 234
Description: Mouse monoclonal to ApoA-V(bd).

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)

80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein

abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS ELISA KIT|Human

EF002719 96 Tests
EUR 689

Rat SARS shRNA Plasmid

20-abx988123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid

20-abx972567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody

APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid

20-abx954245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-SARS-E2 (4A6C9)

LF-MA30016 100 ul
EUR 344
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)

LF-MA30017 100 ul
EUR 354
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)

RP027604 100 ug Ask for price

SARS Recombinant Protein (Human)

RP027607 100 ug Ask for price