Clungene Sars Test Kits

Lab Reagents

Human IgG antibody Laboratories manufactures the clungene sars test kits reagents distributed by Genprice. The Clungene Sars Test Kits reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Clungene products are available in stock. Specificity: Clungene Category: Sars Group: Test Kits

Test Kits information

Pipette Stand Starter Kits
P7700-S2	BenchMark	1 PC	EUR 526.1
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Sars/ Rat Sars ELISA Kit
ELI-41050r	Lifescience Market	96 Tests	EUR 886

MitoPT™ TMRE & TMRM Kits
KF17358	Neuromics	500 Test	EUR 479

MitoPT™ TMRE & TMRM Kits
KF17359	Neuromics	500 Test	EUR 479

Rat Neural Stem Cell Kits
PC37123	Neuromics	1 X 10(6) *minimum order 6 vials*	EUR 957

HISTAR DETECTION SYSTEM Kits (OKSA11259)
OKSA11259	Aviva Systems Biology	50 Tests	EUR 565
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

HISTAR DETECTION SYSTEM Kits (OKSA11260)
OKSA11260	Aviva Systems Biology	150 Tests	EUR 1335
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

HISTAR DETECTION SYSTEM Kits (OKSA11261)
OKSA11261	Aviva Systems Biology	500 Tests	EUR 2019
Description: Description of target: HISTAR DETECTION SYSTEM;Species reactivity: ;Application: IHC-AFF, IHC-FFPE;Assay info: ;Sensitivity:

SARS antibody
70R-20086	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody
70R-1444	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody
70R-1445	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody
39139-100ul	SAB	100ul	EUR 252

SARS Antibody
1-CSB-PA04145A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody
1-CSB-PA020709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA
20-abx904776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932473	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223-SARS
PVT12269	Lifescience Market	2 ug	EUR 391

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-20tests	Accu test	20 tests	EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-40tests	Accu test	40 tests	EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

CellQuanti-Blue Cell Viability Assay Kits
CQBL-05K	BioAssay Systems	5000	EUR 221
Description: Homogeneous assay for cell viability, proliferation, cytotoxcity, high-throµghput screening for anticancer agents. Fluorimetric method (530nm/590nm). Kit size: 5000 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

CellQuanti-Blue Cell Viability Assay Kits
CQBL-10K	BioAssay Systems	10000	EUR 340
Description: Homogeneous assay for cell viability, proliferation, cytotoxcity, high-throµghput screening for anticancer agents. Fluorimetric method (530nm/590nm). Kit size: 10000 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4°C.

CellQuanti-MTT Cell Viability Assay Kits
CQMT-500	BioAssay Systems	500	EUR 210
Description: Colorimetric (570nm) assay for cell viability, proliferation, cytotoxcity, HTS for anticancer agents. Kit size: 500 tests. Shelf life: 12 months. Shipping: ambient temp; storage: 4, -20°C.

MITOCHONDRIAL MEMBRANE POTENTIAL KIT Kits (OKSA11298)
OKSA11298	Aviva Systems Biology	500 Tests	EUR 956
Description: Description of target: MITOCHONDRIAL MEMBRANE POTENTIAL KIT ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

MITOCHONDRIAL MEMBRANE POTENTIAL KIT Kits (OKSA11300)
OKSA11300	Aviva Systems Biology	500 Tests	EUR 956
Description: Description of target: MITOCHONDRIAL MEMBRANE POTENTIAL KIT ;Species reactivity: Human;Application: FC, IF;Assay info: ;Sensitivity:

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg	EnQuireBio	1mg	EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg	EnQuireBio	1mg	EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug	EnQuireBio	20ug	EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug	EnQuireBio	5ug	EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug	EnQuireBio	500ug	EUR 663

SARS Spike Antibody
24216-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24217-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24218-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24219-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24318-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24319-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24320-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24321-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24322-100ul	SAB	100ul	EUR 390

SARS Rabbit pAb
A13350-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A13350-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A13350-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A13350-50ul	Abclonal	50 ul	EUR 223

SARS Blocking Peptide
33R-8713	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide
33R-7048	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody
10R-1976	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody
10C-CR9003M1	Fitzgerald	100 ug	EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]
DAG1861	Creative Diagnostics	500 ug	EUR 2529

SARS S2 [His]
DAG1862	Creative Diagnostics	500 ug	EUR 2529

SARS-E2 Antibody
abx016055-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1720.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1970.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Conjugated Antibody
C39139	SAB	100ul	EUR 397

SARS cloning plasmid
CSB-CL020709HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb
A6733-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A6733-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A6733-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A6733-50ul	Abclonal	50 ul	EUR 223

SARS Polyclonal Antibody
A53977	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate
H-5982.0500	Bachem	0.5mg	EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000	Bachem	1.0mg	EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody
PAab07609	Lifescience Market	100 ug	EUR 386

Anti-SARS antibody
STJ28816	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)
YF-MA10816	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SARS

DNASE TEST AGAR
D04-101-10kg	Alphabiosciences	10 kg	Ask for price

DNASE TEST AGAR
D04-101-2Kg	Alphabiosciences	2 Kg	Ask for price

DNASE TEST AGAR
D04-101-500g	Alphabiosciences	500 g	Ask for price

DERMATOPHYTE TEST AGAR
D04-107-10kg	Alphabiosciences	10 kg	EUR 849

DERMATOPHYTE TEST AGAR
D04-107-2Kg	Alphabiosciences	2 Kg	EUR 224

DERMATOPHYTE TEST AGAR
D04-107-500g	Alphabiosciences	500 g	EUR 97

MOTILITY TEST MEDIUM
M13-121-10kg	Alphabiosciences	10 kg	EUR 1528

MOTILITY TEST MEDIUM
M13-121-2Kg	Alphabiosciences	2 Kg	EUR 371

MOTILITY TEST MEDIUM
M13-121-500g	Alphabiosciences	500 g	EUR 137

SNYDER TEST AGAR
S19-119-10kg	Alphabiosciences	10 kg	EUR 1049

SNYDER TEST AGAR
S19-119-2Kg	Alphabiosciences	2 Kg	EUR 267

SNYDER TEST AGAR
S19-119-500g	Alphabiosciences	500 g	EUR 109

SAM Test Strip
TS00201s-30	Arthus	30 tests	EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip
TS00301s-30	Arthus	30 tests	EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip
TS00401s-30	Arthus	30 tests	EUR 553
Description: Serum homocysteine quantitative test strip

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)
GEN-402-25tests	All test	25 tests	EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug
QP13420-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg
QP13420-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug
QP13420-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug
QP13421-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg
QP13421-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug
QP13421-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug
QP13422-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg
QP13422-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug
QP13422-500ug	EnQuireBio	500ug	EUR 663

Polyclonal SARS Matrix Antibody
APG02976G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated
1-CSB-PA04145B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated
1-CSB-PA04145C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated
1-CSB-PA04145D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)
80R-2099	Fitzgerald	50 ug	EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody
abx018255-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS N Protein Antibody
abx018256-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SARS CoV E Protein
abx060650-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein
abx060652-1mg	Abbexa	1 mg	EUR 1873
Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060653-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060654-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS-CoV Spike Protein
abx060655-1mg	Abbexa	1 mg	EUR 1692
Shipped within 5-10 working days.

SARS ELISA KIT|Human
EF002719	Lifescience Market	96 Tests	EUR 689

Rat SARS shRNA Plasmid
20-abx988123	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid
20-abx972567	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody
APR11178G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid
20-abx954245	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti-SARS-E2 (4A6C9)
LF-MA30016	Abfrontier	100 ul	EUR 344
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)
LF-MA30017	Abfrontier	100 ul	EUR 354
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)
RP027604	ABM	100 ug	Ask for price

SARS Recombinant Protein (Human)
RP027607	ABM	100 ug	Ask for price

SARS Recombinant Protein (Rat)
RP227480	ABM	100 ug	Ask for price

SARS Recombinant Protein (Mouse)
RP170009	ABM	100 ug	Ask for price

SARS Recombinant Protein (Mouse)
RP170012	ABM	100 ug	Ask for price

Anti-SARS-E2 antibody
STJ98377	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody
STJ98378	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein
VAng-Lsx0059-inquire	Creative Biolabs	inquire	Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

CA72-4 ELISA test
24	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA72-4

FERR ( Ferritin) ELISA test
7	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FERR ( Ferritin)

TSH (Thyrotrophin) ELISA test
14	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of TSH (Thyrotrophin)

T3 (Triiodothyronine) ELISA test
15	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T3 (Triiodothyronine)

T4 (Thyroxine) ELISA test
16	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T4 (Thyroxine)

TESTO (Testosterone) ELISA test
19	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of O (osterone)

PROG (Progesterone) ELISA test
20	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PROG (Progesterone)

E2 (Estradiol) ELISA test
5	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of E2 (Estradiol)

PRL (Prolactin) ELISA test
4	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PRL (Prolactin)

Clearview Chlamydia MF test
CV504524	Bionote	1 box	EUR 162
Description: Please check the datasheet of Clearview Chlamydia MF test before using the test.

PreS2-Ag ELISA test
96	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of PreS2-Ag

HBcAb Sandwich ELISA test
95	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBcAb Sandwich

Melamine Rapid Test Kit
abx092011-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

NDV rapid test kit
RG15-03	Bionote	1 box	EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

IBD rapid test strip
RG15-04	Bionote	10 boxes	EUR 148
Description: Please check the datasheet of IBD rapid test strip before using the test.

Rabies rapid test strip
RG18-01	Bionote	10 boxes	EUR 151.92
Description: Please check the datasheet of Rabies rapid test strip before using the test.

Mast/stem Cell Growth Factor Receptor Kit (Kits) Antibody
20-abx116620	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Rabbit ANTI 14-3-3 ISOFORM PANEL Kits (OKSA11258)
OKSA11258	Aviva Systems Biology	1 u	EUR 1236
Description: Description of target: RABBIT ANTI 14-3-3 ISOFORM PANEL;Species reactivity: Sheep;Application: ELISA, IHC-FFPE, WB;Assay info: ;Sensitivity:

Recombinant SARS Associated Coronavirus Matrix
7-07114	CHI Scientific	100µg	Ask for price

Recombinant SARS Associated Coronavirus Matrix
7-07115	CHI Scientific	500µg	Ask for price

Recombinant SARS Associated Coronavirus Matrix
7-07116	CHI Scientific	1000µg	Ask for price

Recombinant SARS Associated Coronavirus Envelope
7-07117	CHI Scientific	100µg	Ask for price

Recombinant SARS Associated Coronavirus Envelope
7-07118	CHI Scientific	500µg	Ask for price

Recombinant SARS Associated Coronavirus Envelope
7-07119	CHI Scientific	1000µg	Ask for price

SARS Coronavirus IgG ELISA Kit
DEIA1035	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit
DEIA1036	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS-CoV spike protein Antibody
abx023139-100ug	Abbexa	100 ug	EUR 857
Shipped within 5-10 working days.

SARS-CoV spike protein Antibody
abx023143-100ug	Abbexa	100 ug	EUR 857
Shipped within 5-10 working days.

SARS Associated Coronavirus Matrix Protein
20-abx260150	Abbexa	EUR 885.00 EUR 342.00 EUR 1372.00	0.5 mg 100 ug 1 mg
Shipped within 5-10 working days.

SARS Associated Coronavirus Envelope Protein
20-abx260151	Abbexa	EUR 885.00 EUR 342.00 EUR 1372.00	0.5 mg 100 ug 1 mg
Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated
A53978	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated
A53979	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated
A53980	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Sars ORF Vector (Rat) (pORF)
ORF075828	ABM	1.0 ug DNA	EUR 506

SARS ORF Vector (Human) (pORF)
ORF009202	ABM	1.0 ug DNA	EUR 95

SARS ORF Vector (Human) (pORF)
ORF009203	ABM	1.0 ug DNA	EUR 95

Sars ORF Vector (Mouse) (pORF)
ORF056671	ABM	1.0 ug DNA	EUR 506

Sars ORF Vector (Mouse) (pORF)
ORF056672	ABM	1.0 ug DNA	EUR 506

Recombinant SARS S1 Protein [His]
VAng-Lsx0061-inquire	Creative Biolabs	inquire	Ask for price
Description: SARS S1 [His], recombinant protein from E. coli.

Recombinant SARS S2 Protein [His]
VAng-Lsx0062-inquire	Creative Biolabs	inquire	Ask for price
Description: SARS S2 [His], recombinant protein from E. coli.

Anti-SARS-CoV-2 Antibody
A2061-50	Biovision	50 µg	EUR 480

Recombinant Coronavirus Nucleoprotein (SARS-CoV)
P1509-10	Biovision	10µg	EUR 551

SARS CoV-2 PCR kit
PCR-H731-48R	Bioingentech	48T	EUR 823

SARS CoV-2 PCR kit
PCR-H731-96R	Bioingentech	96T	EUR 1113

CA125 (Cancer antigen) ELISA test
11	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA125 (Cancer antigen)

CA199 (Cancer antigen) ELISA test
13	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)