Cobas Sars Test Instrument

Lab Reagents

Human IgG antibody Laboratories manufactures the cobas sars test instrument reagents distributed by Genprice. The Cobas Sars Test Instrument reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Cobas products are available in stock. Specificity: Cobas Category: Sars Group: Test Instrument

Test Instrument information

SARS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT12269 2 ug
EUR 391

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS


D04-101-10kg 10 kg Ask for price


D04-101-2Kg 2 Kg Ask for price


D04-101-500g 500 g Ask for price


D04-107-10kg 10 kg
EUR 849


D04-107-2Kg 2 Kg
EUR 224


D04-107-500g 500 g
EUR 97


M13-121-10kg 10 kg
EUR 1528


M13-121-2Kg 2 Kg
EUR 371


M13-121-500g 500 g
EUR 137


S19-119-10kg 10 kg
EUR 1049


S19-119-2Kg 2 Kg
EUR 267


S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)

80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein

abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.


EF002719 96 Tests
EUR 689

Rat SARS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody

APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-SARS-E2 (4A6C9)

LF-MA30016 100 ul
EUR 344
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)

LF-MA30017 100 ul
EUR 354
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)

RP027604 100 ug Ask for price

SARS Recombinant Protein (Human)

RP027607 100 ug Ask for price

SARS Recombinant Protein (Rat)

RP227480 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170009 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170012 100 ug Ask for price

Anti-SARS-E2 antibody

STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein

VAng-Lsx0059-inquire inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

CA72-4 ELISA test

24 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA72-4

FERR ( Ferritin) ELISA test

7 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FERR ( Ferritin)

TSH (Thyrotrophin) ELISA test

14 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of TSH (Thyrotrophin)

T3 (Triiodothyronine) ELISA test

15 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T3 (Triiodothyronine)

T4 (Thyroxine) ELISA test

16 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T4 (Thyroxine)

TESTO (Testosterone) ELISA test

19 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of O (osterone)

PROG (Progesterone) ELISA test

20 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PROG (Progesterone)

E2 (Estradiol) ELISA test

5 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of E2 (Estradiol)

PRL (Prolactin) ELISA test

4 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PRL (Prolactin)

Basic Cytotoxicity Test Kits

CT17001 125 Tests
EUR 409

Basic Cytotoxicity Test Kits

CT17002 250 Tests
EUR 650

Total Cytotoxicity Test Kits

CT17003 125 Tests
EUR 513

Total Cytotoxicity Test Kits

CT17004 250 Tests
EUR 813

Clearview Chlamydia MF test

CV504524 1 box
EUR 162
Description: Please check the datasheet of Clearview Chlamydia MF test before using the test.

PreS2-Ag ELISA test

96 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of PreS2-Ag

HBcAb Sandwich ELISA test

95 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBcAb Sandwich

Melamine Rapid Test Kit

abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

NDV rapid test kit

RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

IBD rapid test strip

RG15-04 10 boxes
EUR 148
Description: Please check the datasheet of IBD rapid test strip before using the test.

Rabies rapid test strip

RG18-01 10 boxes
EUR 151.92
Description: Please check the datasheet of Rabies rapid test strip before using the test.

Recombinant SARS Associated Coronavirus Matrix

7-07114 100µg Ask for price

Recombinant SARS Associated Coronavirus Matrix

7-07115 500µg Ask for price

Recombinant SARS Associated Coronavirus Matrix

7-07116 1000µg Ask for price

Recombinant SARS Associated Coronavirus Envelope

7-07117 100µg Ask for price

Recombinant SARS Associated Coronavirus Envelope

7-07118 500µg Ask for price

Recombinant SARS Associated Coronavirus Envelope

7-07119 1000µg Ask for price

SARS Coronavirus IgG ELISA Kit

DEIA1035 96T
EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit

DEIA1036 96T
EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS-CoV spike protein Antibody

abx023139-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS-CoV spike protein Antibody

abx023143-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Matrix Protein

  • EUR 885.00
  • EUR 342.00
  • EUR 1372.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Envelope Protein

  • EUR 885.00
  • EUR 342.00
  • EUR 1372.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated

A53978 100 µg
EUR 570.55
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated

A53979 100 µg
EUR 570.55
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated

A53980 100 µg
EUR 570.55
Description: reagents widely cited

Sars ORF Vector (Rat) (pORF)

ORF075828 1.0 ug DNA
EUR 506

SARS ORF Vector (Human) (pORF)

ORF009202 1.0 ug DNA
EUR 95

SARS ORF Vector (Human) (pORF)

ORF009203 1.0 ug DNA
EUR 95

Sars ORF Vector (Mouse) (pORF)

ORF056671 1.0 ug DNA
EUR 506

Sars ORF Vector (Mouse) (pORF)

ORF056672 1.0 ug DNA
EUR 506

Recombinant SARS S1 Protein [His]

VAng-Lsx0061-inquire inquire Ask for price
Description: SARS S1 [His], recombinant protein from E. coli.

Recombinant SARS S2 Protein [His]

VAng-Lsx0062-inquire inquire Ask for price
Description: SARS S2 [His], recombinant protein from E. coli.

Anti-SARS-CoV-2 Antibody

A2061-50 50 µg
EUR 480

Recombinant Coronavirus Nucleoprotein (SARS-CoV)

P1509-10 10µg
EUR 551

SARS CoV-2 PCR kit

PCR-H731-48R 48T
EUR 823

SARS CoV-2 PCR kit

PCR-H731-96R 96T
EUR 1113

CA125 (Cancer antigen) ELISA test

11 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA125 (Cancer antigen)

CA199 (Cancer antigen) ELISA test

13 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

FT3 (Free triiodothyronine) ELISA test

17 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FT3 (Free triiodothyronine)

FT4 (Free thyroxine) ELISA test

18 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FT4 (Free thyroxine)

LH (Luteinizing Hormone) ELISA test

2 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of LH (Luteinizing Hormone)

CA153 (Cancer antigen) ELISA test

12 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA153 (Cancer antigen)

CA50 (Cancer antigen) ELISA test

10 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA50 (Cancer antigen)

AFP (Alpha fetoprotein) ELISA test

6 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of AFP (Alpha fetoprotein)

Tetrodotoxin (TTX) ELISA Test Kit

EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Clearview IM Whole Blood test

CV506815 1 box
EUR 106.98
Description: Please check the datasheet of Clearview IM Whole Blood test before using the test.

CEA (Cancer antigen) ELISA test

9 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CEA (Cancer antigen)

HAV antibody IgM ELISA test

75 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HAV antibody IgM

HEV antibody IgM ELISA test

92 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV antibody IgM

Melamine (MEL) Rapid Test Kit

abx092057-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit

abx092058-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit

abx092059-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit

abx092060-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit

abx092063-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.