Kb Diagnostic Test Kit For Sars

Lab Reagents

Human IgG antibody Laboratories manufactures the kb diagnostic test kit for sars reagents distributed by Genprice. The Kb Diagnostic Test Kit For Sars reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Kit. Other Kb products are available in stock. Specificity: Kb Category: Diagnostic Group: Test Kit

Test Kit information

ELISA kit for Mouse Nuclear factor-KB p65 (NF-KB p65)

KTE70510-96T 96T
EUR 572
  • NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transc
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nuclear factor-KB p65 (NF-KB p65) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Test kit for Potential Anti Oxidant (PAO)

LF-EK90001 1x96T
EUR 875

2019-nCoV IgG/IgM RapiCard InstaTest for Whole Blood/Serum/Plasma samples

GEN-176552-25tests 25 tests
EUR 276
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

2019-nCoV IgG/IgM RapiCard InstaTest for Whole Blood/Serum/Plasma samples

GEN-176552-50tests 50 tests
EUR 472
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Mouse antibody for SARS coronavirus nucleoprotein

3851 100 ug
EUR 387.13
Description: This is purified Mouse monoclonal antibody against SARS coronavirus nucleoprotein for WB, ELISA.

Mouse antibody for SARS coronavirus nucleoprotein

3861 100 ug
EUR 387.13
Description: This is purified Mouse monoclonal antibody against SARS coronavirus nucleoprotein for WB, ELISA.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

RACK HOLDER FOR 15ML TEST TUBES

480168 1/pk
EUR 69
Description: Lab Equipment; Constant Temperature Equipment

RACK HOLDER FOR 50ML TEST TUBES

480169 1/pk
EUR 69
Description: Lab Equipment; Constant Temperature Equipment

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

SARS ELISA KIT|Human

EF002719 96 Tests
EUR 689

Recombinant human Chloride channel protein ClC-Kb

P2795 100ug Ask for price
  • Uniprot ID: P51801
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Chloride channel protein ClC-Kb

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Melamine Rapid Test Kit

abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

NDV rapid test kit

RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Diagnostic grade heat shock BSA powder

BAH68-0050 50gm
EUR 373.1
  • Diagnostic grade heat shock BSA powder is indicated as RUO. Do not use on humans.

Diagnostic grade heat shock BSA powder

BAH68-0100 100gm
EUR 477.1
  • Diagnostic grade heat shock BSA powder is indicated as RUO. Do not use on humans.

Diagnostic grade heat shock BSA powder

BAH68-0500 500gm
EUR 617.5
  • Diagnostic grade heat shock BSA powder is indicated as RUO. Do not use on humans.

Diagnostic grade heat shock BSA powder

BAH68-1000 1KG Ask for price
  • Diagnostic grade heat shock BSA powder is indicated as RUO. Do not use on humans.

Diagnostic grade heat shock BSA powder

BAH68-10000 10KG Ask for price
  • Diagnostic grade heat shock BSA powder is indicated as RUO. Do not use on humans.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

KB-5246

HY-19081 5mg
EUR 2809

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat sRANKL(Soluble Receptor Activator of Nuclear factor-kB Ligand) ELISA Kit

ER1604 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 37.5pg/ml

SARS Coronavirus IgG ELISA Kit

DEIA1035 96T
EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit

DEIA1036 96T
EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS CoV-2 PCR kit

PCR-H731-48R 48T
EUR 823

SARS CoV-2 PCR kit

PCR-H731-96R 96T
EUR 1113

Rat Nuclear Factor-kB P65 (NF-kB p65) CLIA Kit

abx196083-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Tetrodotoxin (TTX) ELISA Test Kit

DEIANJ48 96T
EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Melamine (MEL) Rapid Test Kit

abx092057-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit

abx092058-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit

abx092059-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit

abx092060-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit

abx092063-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Sulfonamides (Sas) Rapid Test Kit

abx092064-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit

abx092065-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Ciprofloxacin (CPFX) Rapid Test Kit

abx092066-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit

abx092067-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Brucella Antibody Rapid Test Kit

abx092069-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

PCRAgH5 AIV Detection Test Kit

PD55-02 1 kit
EUR 902.47
Description: Please check the datasheet of PCRAgH5 AIV Detection Test Kit before using the test.

Rapid Leishmania Ab Test Kit

RB2104 1 box
EUR 127
Description: Please check the datasheet of Rapid Leishmania Ab Test Kit before using the test.

Rapid PED Ag Test Kit

RG14-01 1 box
EUR 159.9
Description: Please check the datasheet of Rapid PED Ag Test Kit before using the test.

Antibody ISOTYPING TEST KIT (OKSA11303)

OKSA11303 10 Tests
EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

ELISA kit for Human Nuclear factor-kappa B (NF-kB)

KTE63001-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Nuclear factor-kappa B (NF-kB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nuclear factor-kappa B (NF-kB)

KTE63001-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Nuclear factor-kappa B (NF-kB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nuclear factor-kappa B (NF-kB)

KTE63001-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Nuclear factor-kappa B (NF-kB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nuclear factor-kappa B (NF-kB)

KTE100827-48T 48T
EUR 354
  • Nuclear factor NF-kappa-B p105 subunit isa 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a D
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nuclear factor-kappa B (NF-kB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nuclear factor-kappa B (NF-kB)

KTE100827-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Nuclear factor NF-kappa-B p105 subunit isa 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a D
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nuclear factor-kappa B (NF-kB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nuclear factor-kappa B (NF-kB)

KTE100827-96T 96T
EUR 572
  • Nuclear factor NF-kappa-B p105 subunit isa 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a D
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nuclear factor-kappa B (NF-kB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

1 kb DNA Ladder 2.0 (0.5 kb ~ 10 kb, with loading dye)

W108-100 NULL
EUR 0

1 kb DNA Ladder 2.0 (0.5 kb ~ 10 kb, with loading dye)

W108-500 NULL
EUR 0

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

kb-NB77-78

B4765-10 10 mg
EUR 363
Description: kb-NB77-78 is an analog of CID797718, which is a by-product of the synthesis of the parental compound, CID755673(PKD1 inhibitor).

kb-NB77-78

B4765-25 25 mg
EUR 702
Description: kb-NB77-78 is an analog of CID797718, which is a by-product of the synthesis of the parental compound, CID755673(PKD1 inhibitor).

kb-NB77-78

B4765-5 5 mg
EUR 215
Description: kb-NB77-78 is an analog of CID797718, which is a by-product of the synthesis of the parental compound, CID755673(PKD1 inhibitor).

KB SRC 4

B5673-10 10 mg
EUR 486

KB SRC 4

B5673-50 50 mg
EUR 1845

KB-R7943 mesylate

20-abx076637
  • EUR 356.00
  • EUR 899.00
  • 10 mg
  • 50 mg
  • Shipped within 5-12 working days.

KB-R7943 mesylate

A3525-10 10 mg
EUR 144
Description: KB-R7943 mesylate is a potent and selective inhibitor of Na+/Ca2+ exchanger (NCE) with IC50 value of 0.7 ?M.

KB-R7943 mesylate

A3525-5.1 10 mM (in 1mL DMSO)
EUR 119
Description: KB-R7943 mesylate is a potent and selective inhibitor of Na+/Ca2+ exchanger (NCE) with IC50 value of 0.7 ?M.

KB-R7943 mesylate

A3525-50 50 mg
EUR 380
Description: KB-R7943 mesylate is a potent and selective inhibitor of Na+/Ca2+ exchanger (NCE) with IC50 value of 0.7 ?M.

KB-R7943 (mesylate)

HY-15415 10mg
EUR 167

kb-NB77-78

HY-16698 5mg
EUR 533

pNF-kB-Luc

PVT1322 2 ug
EUR 325

SARS-CoV-2 Antigen ELISA Kit

DEIA2020 96 tests
EUR 905
  • The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit

E4901-100 100 assays
EUR 753

SARS CoV-2 RT PCR kit

RTq-H731-100R 100T
EUR 1311

SARS CoV-2 RT PCR kit

RTq-H731-150R 150T
EUR 1787

SARS CoV-2 RT PCR kit

RTq-H731-50R 50T
EUR 963

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Test Tube rack for 40 x 0.5 ml tubes

B2000-4-T5 1 PC
EUR 127.64
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Test Tube rack for 15 x 50 ml tubes

 -B2000-4-T500 1 PC
EUR 210.29
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Test Tube rack for 41 x 15 ml tubes

  B2000-4-T150 1 PC
EUR 137.21
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Test Tube rack for 76 x 15 ml tubes

  B2000-8-T150 1 PC
EUR 210.29
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Test Tube rack for 30 x 50 ml tubes

  B2000-8-T500 1 PC
EUR 2496.65
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Clenbuterol Rapid Test Kit (Colloidal gold)

abx092040-50tests 50 tests
EUR 272
  • Shipped within 5-12 working days.

Ractopamine Rapid Test Kit (Colloidal gold)

abx092042-50tests 50 tests
EUR 300
  • Shipped within 5-12 working days.

Salbutamol Rapid Test Kit (Colloidal gold)

abx092043-50tests 50 tests
EUR 342
  • Shipped within 5-12 working days.

Chloramphenicol Rapid Test Kit (Colloidal gold)

abx092045-50tests 50 tests
EUR 356
  • Shipped within 5-12 working days.

Quinolones Rapid Test Kit (Colloidal gold)

abx092046-50tests 50 tests
EUR 537
  • Shipped within 5-12 working days.

Sulfonamides Rapid Test Kit (Colloidal gold)

abx092047-50tests 50 tests
EUR 551
  • Shipped within 5-12 working days.