Nutritional status and survival of 8247 cancer patients

Dietary standing and survival of 8247 most cancers sufferers with or with out diabetes mellitus-results from a potential cohort examine

Background: The variety of most cancers sufferers with diabetes mellitus (DM) is steadily rising. Little is thought in regards to the dietary standing of this inhabitants. This examine characterised the dietary standing and survival of most cancers sufferers with diabetes in contrast with these with out diabetes.
Strategies: A complete of 8247 most cancers sufferers had been prospectively enrolled from 72 hospitals in China and adopted till August 2019. A worldwide estimation of the dietary standing was carried out for every participant utilizing standardized instruments. The outcomes had been cancer-specific survival (CSS) and general survival (OS).
Outcomes: The incidence of diabetes was 7.6% in the entire inhabitants. Compared with the non-DM group, the DM group had larger physique weight, however the same fat-free mass, a decrease handgrip energy and a decreased Karnofsky efficiency rating. A better proportion of sufferers with diabetes had been chubby/overweight as indicated by BMI. The proportion of sufferers who had been prone to malnutrition (evaluated by PG-SGA) was larger within the DM group (rating ≥ 4, 56.7% vs 52.9%). Sufferers with DM confirmed a worse CSS (4-year CSS, 62% vs 73%) and OS (4-year OS 39% vs 52%). Diabetes was related to an elevated threat of each cancer-specific (hazard ratio (HR) = 1.282, 95% confidence interval (CI) 1.070-1.536) and general (HR = 1.206, 95% CI 1.040-1.399) mortality.
Conclusions: Most cancers sufferers with diabetes had a bigger physique mass however decrease muscle energy, poorer efficiency standing and better incidence of malnourishment. Diabetes was related to compromised survival. Tailor-made dietary intervention is important for this subpopulation of sufferers.

.

ijddc

ijddc

Anti-VEGF antibody

STJ119887 100 µl
EUR 393.00
Description: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.

Anti-VEGF antibody

STJ97787 200 µl
EUR 197.00
Description: Rabbit polyclonal to VEGF.

Crotalus adamanteus Snake venom metalloproteinase adamalysin-2

1-CSB-EP330325DYB
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Crotalus adamanteus Snake venom metalloproteinase adamalysin-2 expressed in E.coli

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

Naja mossambica Snake venom metalloproteinase-disintegrin-like mocarhagin

1-CSB-EP606027NAH
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Naja mossambica Snake venom metalloproteinase-disintegrin-like mocarhagin expressed in E.coli

Anti-VEGF Antibody Clone VEGF/1063, Unconjugated-100ug

7422-MSM1-P1 100ug
EUR 428.00

Anti-VEGF/VEGF164 Antibody

A00045-1 100ug/vial
EUR 294.00

Anti-VEGF/Vegfa Antibody

A00045-2 100ug/vial
EUR 294.00

Anti-VEGF-C Antibody

A00623 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for VEGF-C Antibody (VEGFC) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-VEGF/VEGFA Antibody

PB9071 100ug/vial
EUR 334.00

Anti-VEGF/VEGFA Antibody

PA1080 100ug/vial
EUR 334.00

Anti-VEGF-C antibody

STJ96662 200 µl
EUR 197.00
Description: Rabbit polyclonal to VEGF-C.

Anti-VEGF-B antibody

STJ96851 200 µl
EUR 197.00
Description: Rabbit polyclonal to VEGF-B.

anti-VEGF Receptor 1

YF-PA11817 50 ug
EUR 363.00
Description: Mouse polyclonal to VEGF Receptor 1

anti-VEGF Receptor 1

YF-PA11818 100 ug
EUR 403.00
Description: Rabbit polyclonal to VEGF Receptor 1

anti-VEGF Receptor 3

YF-PA23727 50 ul
EUR 334.00
Description: Mouse polyclonal to VEGF Receptor 3

VEGF receptor Flt-1 (F56), Peptide Aptamer, FITC labelled

AP-334-F 1 mg Ask for price

VEGF receptor KDR/Flk-1 (K237), Peptide Aptamer, FITC labelled

AP-336-F 1 mg Ask for price

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-b-192 1 kit of 192 tests
EUR 1090.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-b-48 1 kit of 48 tests
EUR 460.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-b-96 1 kit of 96 tests
EUR 615.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Hu-192 1 kit of 192 tests
EUR 679.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Hu-48 1 kit of 48 tests
EUR 316.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Hu-96 1 kit of 96 tests
EUR 409.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Mu-192 1 kit of 192 tests
EUR 938.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Mu-48 1 kit of 48 tests
EUR 407.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Mu-96 1 kit of 96 tests
EUR 539.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Ra-192 1 kit of 192 tests
EUR 989.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Ra-48 1 kit of 48 tests
EUR 425.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DL-EG-VEGF-Ra-96 1 kit of 96 tests
EUR 564.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF)

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-b-48T 48T
EUR 493.00
  • Should the Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma or other biological fluids.

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-b-96T 96T
EUR 641.00
  • Should the Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma or other biological fluids.

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Hu-48T 48T
EUR 336.00
  • Should the Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Hu-96T 96T
EUR 425.00
  • Should the Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Mu-48T 48T
EUR 435.00
  • Should the Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Mu-96T 96T
EUR 561.00
  • Should the Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Ra-48T 48T
EUR 454.00
  • Should the Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Ra-96T 96T
EUR 587.00
  • Should the Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-b-48Tests 48 Tests
EUR 494.00

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-b-96Tests 96 Tests
EUR 684.00

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Hu-48Tests 48 Tests
EUR 317.00

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Hu-96Tests 96 Tests
EUR 431.00

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Mu-48Tests 48 Tests
EUR 429.00

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Mu-96Tests 96 Tests
EUR 591.00

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Ra-48Tests 48 Tests
EUR 450.00

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Ra-96Tests 96 Tests
EUR 622.00

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-b-48Tests 48 Tests
EUR 516.00

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-b-96Tests 96 Tests
EUR 716.00

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Hu-48Tests 48 Tests
EUR 330.00

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Hu-96Tests 96 Tests
EUR 450.00

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Mu-48Tests 48 Tests
EUR 447.00

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Mu-96Tests 96 Tests
EUR 618.00

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Ra-48Tests 48 Tests
EUR 470.00

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Ra-96Tests 96 Tests
EUR 651.00

VEGF

PR15028 10 ug
EUR 461.00

VEGF

LF-PR009 10 ug
EUR 255.00
Description: VEGF protein

VEGF

MO15067 500 ug
EUR 910.00

VEGF receptor KDR and Flt-1 (v107), Peptide Aptamer, FITC labelled

AP-335-F 1 mg Ask for price

VEGF-stimulated Human Umbilical Vein Endothelial Cell, Peptide Aptamer, FITC labelled

AP-338-F 1 mg Ask for price

VEGF-stimulated human umbilical vein endothelial cells, Peptide Aptamer, FITC labelled

AP-339-F 1 mg Ask for price

Anti-VEGF (Bevacizumab), humanized Antibody

A1045-100
EUR 501.00

Anti-VEGF Rabbit Monoclonal Antibody

M00045-1 100ug/vial
EUR 397.00
Description: Rabbit Monoclonal VEGF Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC and tested in Human, Mouse.

Anti-VEGF Receptor 3 (5B6)

YF-MA10355 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (5F11)

YF-MA13094 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (6F9)

YF-MA13095 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (5B5)

YF-MA13096 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (4D1)

YF-MA13097 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (2E3)

YF-MA13098 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (1C1)

YF-MA13099 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (6B7)

YF-MA13100 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 2 (2A2)

YF-MA13909 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (4A2)

YF-MA13910 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (2C5)

YF-MA13911 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (4B5)

YF-MA13912 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (4F1)

YF-MA13913 100 ug
EUR 363.00
Description: Mouse monoclonal to VEGF Receptor 2

anti-Apolipoprotein F

YF-PA10244 50 ul
EUR 363.00
Description: Mouse polyclonal to Apolipoprotein F

anti-Apolipoprotein F

YF-PA10245 50 ug
EUR 363.00
Description: Mouse polyclonal to Apolipoprotein F

anti-Apolipoprotein F

YF-PA10246 100 ug
EUR 403.00
Description: Rabbit polyclonal to Apolipoprotein F

anti-Cathepsin F

YF-PA15821 50 ul
EUR 363.00
Description: Mouse polyclonal to Cathepsin F

anti-Cathepsin F

YF-PA15822 50 ug
EUR 363.00
Description: Mouse polyclonal to Cathepsin F

anti-Cyclophilin F

YF-PA25484 50 ul
EUR 334.00
Description: Mouse polyclonal to Cyclophilin F

VEGF-A(VEGF/1063) Antibody

BNCA1063-250 250uL
EUR 383.00
Description: Primary antibody against VEGF-A(VEGF/1063), APC conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC801063-100 100uL
EUR 199.00
Description: Primary antibody against VEGF-A(VEGF/1063), CF680 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC801063-500 500uL
EUR 544.00
Description: Primary antibody against VEGF-A(VEGF/1063), CF680 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNUM1063-50 50uL
EUR 395.00
Description: Primary antibody against VEGF-A(VEGF/1063), 1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC041063-100 100uL
EUR 199.00
Description: Primary antibody against VEGF-A(VEGF/1063), CF405S conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC041063-500 500uL
EUR 544.00
Description: Primary antibody against VEGF-A(VEGF/1063), CF405S conjugate, Concentration: 0.1mg/mL

Impression of diabetes mellitus on feminine topics present process transcatheter aortic valve implantation: Insights from the WIN-TAVI worldwide registry

Background: Feminine topics represent half of all transcatheter aortic valve implantation (TAVI) candidates, however the affiliation between necessary comorbidities resembling diabetes mellitus (DM) and medical outcomes after TAVI stays unclear on this group.
Methodology: WIN-TAVI is a real-world worldwide registry of solely feminine topics present process TAVI. The examine inhabitants was stratified into these with (DM) and people with out DM (NDM). Valve Educational Analysis Consortium (VARC)-2 efficacy (composite of all-cause dying, stroke, myocardial infarction, hospitalization for valve-related signs or worsening congestive coronary heart failure, or valve-related dysfunction) was the first endpoint for this evaluation.
Outcomes: Of the 1012 topics included on this examine, 264 (26.1%) had DM at baseline. DM sufferers had been youthful however had a better burden of comorbidities. There have been no variations in VARC-2 efficacy occasions between DM and NDM sufferers at 30 days or 1 yr. Conversely, sufferers with DM had a decrease threat of VARC-2 life threatening bleeding at 30 days and 1 yr after TAVI in comparison with NDM sufferers, which remained important even after multivariable adjustment (HR, 0.34, 95% CI, 0.12-0.99; p = .047). Within the subgroup evaluation, insulin-dependent DM was not related to an elevated threat of hostile outcomes.
Conclusions: Amongst feminine sufferers present process TAVI, greater than one-fourth of the themes offered with DM. At 1-year follow-up, DM was related to decrease bleeding issues and no improve within the threat of different hostile occasions, together with mortality, after TAVI.

The Position of Diabetes Mellitus as an Impact Modifier of the Affiliation Between Smoking Cessation and Its Medical Prognoses: An Observational Cohort Research

The smoker’s paradox refers to an elevated threat of hostile medical outcomes after smoking cessation in sufferers with coronary artery illness. The mechanisms concerned are controversial. The current examine evaluated the impact of delay in smoking cessation on medical outcomes amongst sufferers after percutaneous coronary intervention (PCI) stratified by diabetes mellitus (DM). Sufferers included on this examine got here from a longtime Fu Wai hospital PCI cohort. Smoking conduct was recorded; medical finish factors included all-cause mortality and repeat revascularization.
The analyses had been based mostly on 8489 people who smoke who underwent PCI. Sufferers with and with out DM had been examined individually. Multivariable mannequin evaluation urged that smoking cessation was related to important decrease all-cause mortality each for non-DM and DM sufferers. The smoking paradox was noticed for revascularization. Nonetheless, the elevated threat of repeat revascularization correlated with quitting time amongst non-DM sufferers solely, particularly in the event that they stopped smoking late (>90 days) after their index process (adjusted hazard ratio, 3.40; 95% CI: 2.45-4.72). In conclusion, smoking cessation is related to a decrease mortality fee for PCI sufferers. Nonetheless, the relative profit on repeated revascularization was solely noticed amongst non-DM sufferers in the event that they stop smoking early.

GRO / KC (CXCL1) Protein

20-abx261870
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317.00
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164.00

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317.00
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO/KC (CXCL1), Rat Recombinant

P1288-25
EUR 370.00

GRO/KC (CXCL1), Rat Recombinant

P1288-5
EUR 175.00

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317.00
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317.00
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Rat CXCL1/CINC-1/KC ELISA Kit

RK00196 96 Tests
EUR 521.00

KC protein (Mouse)

30R-AK001 20 ug
EUR 273.00
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277.00
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260.00

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881.00

KC antibody

70R-KR006 50 ug
EUR 273.00
Description: Affinity purified Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527.00
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492.00
Description: Rabbit polyclonal KC antibody

KC Antibody

5211-100
EUR 376.00

KC Antibody

5212-100
EUR 392.00

KC Antibody

5212-30T
EUR 146.00

KC antibody

20R-1786 100 ug
EUR 651.00
Description: Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025.00
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725.00
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294.00

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294.00

Mouse CXCL1 shRNA Plasmid

20-abx970673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CXCL1 ELISA Kit

55R-1741 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533.00

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC Blocking Peptide

5212BP-50
EUR 153.00

KC Blocking Peptide

33R-11041 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373.00

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363.00

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140.00

CXCL1 siRNA

20-abx913248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913249
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx901350
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 antibody

70R-15473 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-16681 50 ul
EUR 435.00
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-14297 100 ug
EUR 327.00
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

1-CSB-PA009036
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

Cxcl1 Antibody

1-CSB-PA09217A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1 Antibody

1-CSB-PA06097A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1 Antibody

33054-100ul 100ul
EUR 252.00

CXCL1 protein

30R-3156 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein

CXCL1 Antibody

43679-100ul 100ul
EUR 252.00

CXCL1 Antibody

1-CSB-PA006239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1/GRO

E21-597 10ug
EUR 343.00

CXCL1/GRO

EF012822 96 Tests
EUR 689.00

pEGFP- CXCL1

PVT10178 2 ug
EUR 301.00

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881.00

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95.00

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456.00
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648.00

GRO/KC, murine recombinant

4210-100
EUR 773.00

GRO/KC, murine recombinant

4210-1000
EUR 3856.00

GRO/KC, murine recombinant

4210-20
EUR 256.00

CXCL1 Polyclonal Antibody

E-AB-36301-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: CXCL1 (C-X-C Motif Chemokine Ligand 1) is a Protein Coding gene. Diseases associated with CXCL1 inclu
  • Show more
Description: Rabbit antibody against Human CXCL1 for IHC-p,ELISA applications.

CXCL1 Polyclonal Antibody

E-AB-36301-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: CXCL1 (C-X-C Motif Chemokine Ligand 1) is a Protein Coding gene. Diseases associated with CXCL1 inclu
  • Show more
Description: Rabbit antibody against Human CXCL1 for IHC-p,ELISA applications.

CXCL1 Polyclonal Antibody

E-AB-36301-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: CXCL1 (C-X-C Motif Chemokine Ligand 1) is a Protein Coding gene. Diseases associated with CXCL1 inclu
  • Show more
Description: Rabbit antibody against Human CXCL1 for IHC-p,ELISA applications.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (biotin)

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 Blocking Peptide

20-abx061039
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397.00

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

Recombinant Human CXCL1

P0207 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

pCMV-SPORT6-CXCL1

PVT13291 2 ug
EUR 391.00

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)

70027-05141 150 ug
EUR 428.00

Mouse Growth-regulated alpha protein (Cxcl1)

1-CSB-RP092174m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

GRO-alpha/CXCL1 (CHO-expressed), Mouse

HY-P7186 50ug
EUR 337.00

Mouse CXCL1/GROα ELISA kit (4X96T)

LF-EK50474 4×96T
EUR 2201.00

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)

K4368201 3 x 1.0 ug
EUR 339.00