Nutritional status and survival of 8247 cancer patients

Dietary standing and survival of 8247 most cancers sufferers with or with out diabetes mellitus-results from a potential cohort examine

Background: The variety of most cancers sufferers with diabetes mellitus (DM) is steadily rising. Little is thought in regards to the dietary standing of this inhabitants. This examine characterised the dietary standing and survival of most cancers sufferers with diabetes in contrast with these with out diabetes.
Strategies: A complete of 8247 most cancers sufferers had been prospectively enrolled from 72 hospitals in China and adopted till August 2019. A worldwide estimation of the dietary standing was carried out for every participant utilizing standardized instruments. The outcomes had been cancer-specific survival (CSS) and general survival (OS).
Outcomes: The incidence of diabetes was 7.6% in the entire inhabitants. Compared with the non-DM group, the DM group had larger physique weight, however the same fat-free mass, a decrease handgrip energy and a decreased Karnofsky efficiency rating. A better proportion of sufferers with diabetes had been chubby/overweight as indicated by BMI. The proportion of sufferers who had been prone to malnutrition (evaluated by PG-SGA) was larger within the DM group (rating ≥ 4, 56.7% vs 52.9%). Sufferers with DM confirmed a worse CSS (4-year CSS, 62% vs 73%) and OS (4-year OS 39% vs 52%). Diabetes was related to an elevated threat of each cancer-specific (hazard ratio (HR) = 1.282, 95% confidence interval (CI) 1.070-1.536) and general (HR = 1.206, 95% CI 1.040-1.399) mortality.
Conclusions: Most cancers sufferers with diabetes had a bigger physique mass however decrease muscle energy, poorer efficiency standing and better incidence of malnourishment. Diabetes was related to compromised survival. Tailor-made dietary intervention is important for this subpopulation of sufferers.

.

ijddc

ijddc

Anti-VEGF antibody

STJ119887 100 µl
EUR 393
Description: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.

VEGF-KDR, Peptide Aptamer, FITC labelled

AP-337-F 1 mg Ask for price

Crotalus adamanteus Snake venom metalloproteinase adamalysin-2

1-CSB-EP330325DYB
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Crotalus adamanteus Snake venom metalloproteinase adamalysin-2 expressed in E.coli

Anti-VEGF/VEGF164 Antibody

A00045-1 100ug/vial
EUR 294

Anti-VEGF/Vegfa Antibody

A00045-2 100ug/vial
EUR 294

Anti-VEGF-C Antibody

A00623 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for VEGF-C Antibody (VEGFC) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-VEGF/VEGFA Antibody

PB9071 100ug/vial
EUR 334

Anti-VEGF/VEGFA Antibody

PA1080 100ug/vial
EUR 334

Anti-VEGF-B antibody

STJ96851 200 µl
EUR 197
Description: Rabbit polyclonal to VEGF-B.

Anti-VEGF-C antibody

STJ96662 200 µl
EUR 197
Description: Rabbit polyclonal to VEGF-C.

anti-VEGF Receptor 1

YF-PA11817 50 ug
EUR 363
Description: Mouse polyclonal to VEGF Receptor 1

anti-VEGF Receptor 1

YF-PA11818 100 ug
EUR 403
Description: Rabbit polyclonal to VEGF Receptor 1

anti-VEGF Receptor 3

YF-PA23727 50 ul
EUR 334
Description: Mouse polyclonal to VEGF Receptor 3

Anti-VEGF Antibody Clone VEGF/1063, Unconjugated-100ug

7422-MSM1-P1 100ug
EUR 428

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Naja mossambica Snake venom metalloproteinase-disintegrin-like mocarhagin

1-CSB-EP606027NAH
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Naja mossambica Snake venom metalloproteinase-disintegrin-like mocarhagin expressed in E.coli

anti-Apolipoprotein F

YF-PA10244 50 ul
EUR 363
Description: Mouse polyclonal to Apolipoprotein F

anti-Apolipoprotein F

YF-PA10245 50 ug
EUR 363
Description: Mouse polyclonal to Apolipoprotein F

anti-Apolipoprotein F

YF-PA10246 100 ug
EUR 403
Description: Rabbit polyclonal to Apolipoprotein F

anti-Cathepsin F

YF-PA15821 50 ul
EUR 363
Description: Mouse polyclonal to Cathepsin F

anti-Cathepsin F

YF-PA15822 50 ug
EUR 363
Description: Mouse polyclonal to Cathepsin F

anti-Cyclophilin F

YF-PA25484 50 ul
EUR 334
Description: Mouse polyclonal to Cyclophilin F

VEGF receptor Flt-1 (F56), Peptide Aptamer, FITC labelled

AP-334-F 1 mg Ask for price

Anti-VEGF (Bevacizumab), humanized Antibody

A1045-100
EUR 501

Anti-VEGF Rabbit Monoclonal Antibody

M00045-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal VEGF Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC and tested in Human, Mouse.

Anti-VEGF Receptor 3 (5F11)

YF-MA13094 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (6F9)

YF-MA13095 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (5B5)

YF-MA13096 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (4D1)

YF-MA13097 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (2E3)

YF-MA13098 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (1C1)

YF-MA13099 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 3 (6B7)

YF-MA13100 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Anti-VEGF Receptor 2 (2A2)

YF-MA13909 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (4A2)

YF-MA13910 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (2C5)

YF-MA13911 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (4B5)

YF-MA13912 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF Receptor 2 (4F1)

YF-MA13913 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 2

Anti-VEGF-A Humanized Antibody

A2136-100 100 µg
EUR 510

Anti-VEGF Receptor 3 (5B6)

YF-MA10355 100 ug
EUR 363
Description: Mouse monoclonal to VEGF Receptor 3

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-b-48T 48T
EUR 493
  • Should the Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma or other biological fluids.

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-b-96T 96T
EUR 641
  • Should the Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma or other biological fluids.

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Hu-48T 48T
EUR 336
  • Should the Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Hu-96T 96T
EUR 425
  • Should the Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Mu-48T 48T
EUR 435
  • Should the Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Mu-96T 96T
EUR 561
  • Should the Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Ra-48T 48T
EUR 454
  • Should the Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

DLR-EG-VEGF-Ra-96T 96T
EUR 587
  • Should the Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-b-48Tests 48 Tests
EUR 516

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-b-96Tests 96 Tests
EUR 716

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Hu-48Tests 48 Tests
EUR 330

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Hu-96Tests 96 Tests
EUR 450

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Mu-48Tests 48 Tests
EUR 447

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Mu-96Tests 96 Tests
EUR 618

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Ra-48Tests 48 Tests
EUR 470

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RDR-EG-VEGF-Ra-96Tests 96 Tests
EUR 651

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-b-48Tests 48 Tests
EUR 494

Bovine Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-b-96Tests 96 Tests
EUR 684

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Hu-48Tests 48 Tests
EUR 317

Human Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Hu-96Tests 96 Tests
EUR 431

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Mu-48Tests 48 Tests
EUR 429

Mouse Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Mu-96Tests 96 Tests
EUR 591

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Ra-48Tests 48 Tests
EUR 450

Rat Endocrine Gland Derived Vascular Endothelial Growth Factor (EG-VEGF) ELISA Kit

RD-EG-VEGF-Ra-96Tests 96 Tests
EUR 622

VEGF

PR15028 10 ug
EUR 461

VEGF

MO15067 500 ug
EUR 910

VEGF

LF-PR009 10 ug
EUR 255
Description: VEGF protein

VEGF receptor KDR/Flk-1 (K237), Peptide Aptamer, FITC labelled

AP-336-F 1 mg Ask for price

VEGF receptor KDR and Flt-1 (v107), Peptide Aptamer, FITC labelled

AP-335-F 1 mg Ask for price

VEGF-stimulated Human Umbilical Vein Endothelial Cell, Peptide Aptamer, FITC labelled

AP-338-F 1 mg Ask for price

VEGF-stimulated human umbilical vein endothelial cells, Peptide Aptamer, FITC labelled

AP-339-F 1 mg Ask for price

VEGF-A(VEGF/1063) Antibody

BNC611063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF660R conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC611063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF660R conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC401063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF640R conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC401063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF640R conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC431063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF543 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC431063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF543 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC471063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF647 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC471063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF647 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC551063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF555 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC551063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF555 conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC051063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF405M conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC051063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF405M conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC041063-100 100uL
EUR 199
Description: Primary antibody against VEGF-A(VEGF/1063), CF405S conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNC041063-500 500uL
EUR 544
Description: Primary antibody against VEGF-A(VEGF/1063), CF405S conjugate, Concentration: 0.1mg/mL

VEGF-A(VEGF/1063) Antibody

BNUB1063-100 100uL
EUR 209
Description: Primary antibody against VEGF-A(VEGF/1063), Concentration: 0.2mg/mL

VEGF-A(VEGF/1063) Antibody

BNUB1063-500 500uL
EUR 458
Description: Primary antibody against VEGF-A(VEGF/1063), Concentration: 0.2mg/mL

VEGF-A(VEGF/1063) Antibody

BNUM1063-50 50uL
EUR 395
Description: Primary antibody against VEGF-A(VEGF/1063), 1mg/mL

Impression of diabetes mellitus on feminine topics present process transcatheter aortic valve implantation: Insights from the WIN-TAVI worldwide registry

Background: Feminine topics represent half of all transcatheter aortic valve implantation (TAVI) candidates, however the affiliation between necessary comorbidities resembling diabetes mellitus (DM) and medical outcomes after TAVI stays unclear on this group.
Methodology: WIN-TAVI is a real-world worldwide registry of solely feminine topics present process TAVI. The examine inhabitants was stratified into these with (DM) and people with out DM (NDM). Valve Educational Analysis Consortium (VARC)-2 efficacy (composite of all-cause dying, stroke, myocardial infarction, hospitalization for valve-related signs or worsening congestive coronary heart failure, or valve-related dysfunction) was the first endpoint for this evaluation.
Outcomes: Of the 1012 topics included on this examine, 264 (26.1%) had DM at baseline. DM sufferers had been youthful however had a better burden of comorbidities. There have been no variations in VARC-2 efficacy occasions between DM and NDM sufferers at 30 days or 1 yr. Conversely, sufferers with DM had a decrease threat of VARC-2 life threatening bleeding at 30 days and 1 yr after TAVI in comparison with NDM sufferers, which remained important even after multivariable adjustment (HR, 0.34, 95% CI, 0.12-0.99; p = .047). Within the subgroup evaluation, insulin-dependent DM was not related to an elevated threat of hostile outcomes.
Conclusions: Amongst feminine sufferers present process TAVI, greater than one-fourth of the themes offered with DM. At 1-year follow-up, DM was related to decrease bleeding issues and no improve within the threat of different hostile occasions, together with mortality, after TAVI.

The Position of Diabetes Mellitus as an Impact Modifier of the Affiliation Between Smoking Cessation and Its Medical Prognoses: An Observational Cohort Research

The smoker’s paradox refers to an elevated threat of hostile medical outcomes after smoking cessation in sufferers with coronary artery illness. The mechanisms concerned are controversial. The current examine evaluated the impact of delay in smoking cessation on medical outcomes amongst sufferers after percutaneous coronary intervention (PCI) stratified by diabetes mellitus (DM). Sufferers included on this examine got here from a longtime Fu Wai hospital PCI cohort. Smoking conduct was recorded; medical finish factors included all-cause mortality and repeat revascularization.
The analyses had been based mostly on 8489 people who smoke who underwent PCI. Sufferers with and with out DM had been examined individually. Multivariable mannequin evaluation urged that smoking cessation was related to important decrease all-cause mortality each for non-DM and DM sufferers. The smoking paradox was noticed for revascularization. Nonetheless, the elevated threat of repeat revascularization correlated with quitting time amongst non-DM sufferers solely, particularly in the event that they stopped smoking late (>90 days) after their index process (adjusted hazard ratio, 3.40; 95% CI: 2.45-4.72). In conclusion, smoking cessation is related to a decrease mortality fee for PCI sufferers. Nonetheless, the relative profit on repeated revascularization was solely noticed amongst non-DM sufferers in the event that they stop smoking early.

GRO / KC (CXCL1) Protein

20-abx261870
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GRO1/KC Mouse Recombinant Protein (CXCL1)

PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.

Recombinant Mouse (E.Coli) GRO/KC (CXCL1)

RP-1037 5 ug
EUR 164

GRO/KC (CXCL1), Rat Recombinant

P1288-25
EUR 370

GRO/KC (CXCL1), Rat Recombinant

P1288-5
EUR 175

Recombinant Murine KC (CXCL1) Protein

PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

GRO, KC, CXCL1, rRtGRO, rat

RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag

PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)

RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Rat GRO/KC (CXCL1) Protein

PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.

Rat CXCL1/CINC-1/KC ELISA Kit

RK00196 96 Tests
EUR 521

KC protein (Mouse)

30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein

Anti-CXCL1 antibody

STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.

Anti-CXCL1 antibody

STJ72026 100 µg
EUR 260

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Rabbit Anti Mouse Cxcl1 Polyclonal Antibody

CPBT-65100RM 0.1 mg
EUR 881

KC antibody

20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody

KC antibody

70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody

KC Antibody

5211-100
EUR 376

KC Antibody

5212-100
EUR 392

KC Antibody

5212-30T
EUR 146

KC antibody

70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

anti-7-ketocholesterol (7-KC) (35A)

LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)

Anti-GRO alpha/Cxcl1 Antibody

A00533 100ug/vial
EUR 294

Anti-GRO alpha/CXCL1 Antibody

PA1760 100ug/vial
EUR 294

KC Blocking Peptide

33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298

KC Blocking Peptide

5212BP-50
EUR 153

Polyclonal KC Antibody

APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:

KC 12291 hydrochloride

B7332-10 10 mg
EUR 373

KC 12291 hydrochloride

B7332-50 50 mg
EUR 1363

Mouse CXCL1 ELISA Kit

55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory

Mouse CXCL1 shRNA Plasmid

20-abx970673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRO-alpha/CXCL1, Mouse

HY-P7188 50ug
EUR 533

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse keinocyte chemoattractant (KC) ELISA kit

E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CXCL1 protein

30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein

CXCL1 antibody

70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody

CXCL1 antibody

70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody

CXCL1 Antibody

33054-100ul 100ul
EUR 252

CXCL1 Antibody

43679-100ul 100ul
EUR 252

CXCL1 Antibody

1-CSB-PA006239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXCL1 Antibody

1-CSB-PA06097A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Cxcl1 Antibody

1-CSB-PA09217A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CXCL1/GRO

E21-597 10ug
EUR 343

CXCL1/GRO

EF012822 96 Tests
EUR 689

CXCL1 Antibody

1-CSB-PA009036
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

CXCL1 siRNA

20-abx901350
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CXCL1 siRNA

20-abx913249
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pEGFP- CXCL1

PVT10178 2 ug
EUR 301

Rabbit Anti Rat Cxcl1 Polyclonal Antibody

CPBT-65101RR 0.1 mg
EUR 881

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

KiloGreen 2X qPCR MasterMix-iCycler

MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140

GRO/KC, murine recombinant

4210-100
EUR 773

GRO/KC, murine recombinant

4210-1000
EUR 3856

GRO/KC, murine recombinant

4210-20
EUR 256

Mouse CXCL1 Detection Assay Kit

6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit

CXCL1 protein (Mouse) (His tag)

80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

CXCL1 protein (Mouse) (His tag)

80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)

ELISA kit for Mouse CXCL1

EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse CXCL1 PicoKine ELISA Kit

EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.

Mouse CXCL1/GROα ELISA kit

LF-EK50473 1×96T
EUR 648

Cxcl1 ORF Vector (Mouse) (pORF)

ORF042286 1.0 ug DNA
EUR 95

CXCL1 ELISA Kit (Mouse) (OKAN04583)

OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

CXCL1 ELISA Kit (Mouse) (OKBB00312)

OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml

CXCL1 ELISA Kit (Mouse) (OKCD05712)

OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)

OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL

CXCL1 Blocking Peptide

33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502

CXCL1 antibody (HRP)

60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)

CXCL1 antibody (FITC)

60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)

CXCL1 antibody (biotin)

60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)

CXCL1 Blocking Peptide

20-abx061039
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CXCL1 Conjugated Antibody

C33054 100ul
EUR 397

CXCL1 cloning plasmid

CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.

Cxcl1 Polyclonal Antibody

A51950 100 µg
EUR 570.55
Description: fast delivery possible

CXCL1 Polyclonal Antibody

A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research

Recombinant Human CXCL1

P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1

pCMV-SPORT6-CXCL1

PVT13291 2 ug
EUR 391

Mouse CXCL1 AssayLite Antibody (FITC Conjugate)

70027-05141 150 ug
EUR 428

Mouse Growth-regulated alpha protein (Cxcl1)

1-CSB-RP092174m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli

GRO-alpha/CXCL1 (CHO-expressed), Mouse

HY-P7186 50ug
EUR 337

Cxcl1 sgRNA CRISPR Lentivector set (Mouse)

K4368201 3 x 1.0 ug
EUR 339

Mouse CXCL1/GROα ELISA kit (4X96T)

LF-EK50474 4×96T
EUR 2201