Roche Sars Test Near Me

Lab Reagents

Human IgG antibody Laboratories manufactures the roche sars test near me reagents distributed by Genprice. The Roche Sars Test Near Me reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Roche products are available in stock. Specificity: Roche Category: Sars Group: Test Near

Test Near information

SARS siRNA
20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA
20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS
PVT12269 2 ug
EUR 391

Opti-Seal qPCR Roche 480 (Low profile)
G913 100 Plates/Case
EUR 302

Opti-Seal qPCR Roche 480 (Low profile)
G914 10 Plates/Box
EUR 76

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

N-Me-Tyr(Me)-OH
E-2160.0250 250.0mg
EUR 139
Description: Sum Formula: C11H15NO3; CAS# [52939-33-0]

N-Me-Tyr(Me)-OH
E-2160.1000 1.0g
EUR 368
Description: Sum Formula: C11H15NO3; CAS# [52939-33-0]

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug 500ug
EUR 663

SARS Spike Antibody
24216-100ul 100ul
EUR 390

SARS Spike Antibody
24217-100ul 100ul
EUR 390

SARS Spike Antibody
24218-100ul 100ul
EUR 390

SARS Spike Antibody
24219-100ul 100ul
EUR 390

SARS Spike Antibody
24318-100ul 100ul
EUR 390

SARS Matrix Antibody
24319-100ul 100ul
EUR 390

SARS Matrix Antibody
24320-100ul 100ul
EUR 390

SARS Envelope Antibody
24321-100ul 100ul
EUR 390

SARS Envelope Antibody
24322-100ul 100ul
EUR 390

SARS Rabbit pAb
A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb
A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb
A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb
A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide
33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide
33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody
10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody
10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]
DAG1861 500 ug
EUR 2529

SARS S2 [His]
DAG1862 500 ug
EUR 2529

SARS-E2 Antibody
abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody
C39139 100ul
EUR 397

SARS cloning plasmid
CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb
A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb
A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb
A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb
A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody
A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate
H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody
PAab07609 100 ug
EUR 386

Anti-SARS antibody
STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)
YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

Fmoc-N-Me-Ser(Me)-OH
5-05477 1g Ask for price

Fmoc-N-Me-Ser(Me)-OH
5-05478 5g Ask for price

DNASE TEST AGAR
D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR
D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR
D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR
D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR
D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR
D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM
M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM
M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM
M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR
S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR
S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR
S19-119-500g 500 g
EUR 109

SAM Test Strip
TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip
TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip
TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

ME-0328
2751-25
EUR 675

ME-0328
2751-5
EUR 207

DCPLA-ME
HY-108599A 10mM/1mL
EUR 492

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)
GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug
QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg
QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug
QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug
QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg
QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug
QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug
QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg
QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug
QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody
APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated
1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated
1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated
1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)
80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody
abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody
abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein
abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein
abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein
abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS ELISA KIT|Human
EF002719 96 Tests
EUR 689

Rat SARS shRNA Plasmid
20-abx988123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid
20-abx972567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody
APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid
20-abx954245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-SARS-E2 (4A6C9)
LF-MA30016 100 ul
EUR 344
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)
LF-MA30017 100 ul
EUR 354
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)
RP027604 100 ug Ask for price

SARS Recombinant Protein (Human)
RP027607 100 ug Ask for price

SARS Recombinant Protein (Rat)
RP227480 100 ug Ask for price

SARS Recombinant Protein (Mouse)
RP170009 100 ug Ask for price

SARS Recombinant Protein (Mouse)
RP170012 100 ug Ask for price

Anti-SARS-E2 antibody
STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody
STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein
VAng-Lsx0059-inquire inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

Polyclonal OTUD4 Antibody (C-Term, near)
APG00577G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human OTUD4 (C-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal UHMK1 Antibody (C-Terminus, near)
APG00599G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UHMK1 (C-Terminus, near). This antibody is tested and proven to work in the following applications:

Polyclonal RPS6KA2 Antibody (C-Term, near)
AMM07655G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RPS6KA2 (C-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal VLCAD Antibody (C-Term, near)
APR10741G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VLCAD (C-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal VLCAD Antibody (N-Terminus, near)
APR10742G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VLCAD (N-Terminus, near). This antibody is tested and proven to work in the following applications:

Polyclonal BLK Antibody (N-Term, near)
APG00740G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human BLK (N-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal NDRG2 Antibody (N-Term, near)
APG00750G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDRG2 (N-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal OAZ Antibody (N-Term, near)
AMM06879G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human OAZ (N-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal MC5R Antibody (N-Term, near)
APR12511G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MC5R (N-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal HAMP Antibody (N-Term, near)
AMM05296G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HAMP (N-Term, near). This antibody is tested and proven to work in the following applications:

CA72-4 ELISA test
24 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA72-4

FERR ( Ferritin) ELISA test
7 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FERR ( Ferritin)

TSH (Thyrotrophin) ELISA test
14 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of TSH (Thyrotrophin)

T3 (Triiodothyronine) ELISA test
15 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T3 (Triiodothyronine)

T4 (Thyroxine) ELISA test
16 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T4 (Thyroxine)

TESTO (Testosterone) ELISA test
19 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of O (osterone)

PROG (Progesterone) ELISA test
20 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PROG (Progesterone)

E2 (Estradiol) ELISA test
5 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of E2 (Estradiol)

PRL (Prolactin) ELISA test
4 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PRL (Prolactin)

Basic Cytotoxicity Test Kits
CT17001 125 Tests
EUR 409

Basic Cytotoxicity Test Kits
CT17002 250 Tests
EUR 650

Total Cytotoxicity Test Kits
CT17003 125 Tests
EUR 513

Total Cytotoxicity Test Kits
CT17004 250 Tests
EUR 813

Clearview Chlamydia MF test
CV504524 1 box
EUR 162
Description: Please check the datasheet of Clearview Chlamydia MF test before using the test.

PreS2-Ag ELISA test
96 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of PreS2-Ag

HBcAb Sandwich ELISA test
95 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBcAb Sandwich

Melamine Rapid Test Kit
abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

NDV rapid test kit
RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

IBD rapid test strip
RG15-04 10 boxes
EUR 148
Description: Please check the datasheet of IBD rapid test strip before using the test.

Rabies rapid test strip
RG18-01 10 boxes
EUR 151.92
Description: Please check the datasheet of Rabies rapid test strip before using the test.

Fmoc-Ala-Ser[Psi(Me,Me)Pro]-OH
5-07023 1g Ask for price

Fmoc-Ala-Ser[Psi(Me,Me)Pro]-OH
5-07024 5g Ask for price

Fmoc-Ala-Thr[Psi(Me,Me)Pro]-OH
5-07025 1g Ask for price

Fmoc-Ala-Thr[Psi(Me,Me)Pro]-OH
5-07026 5g Ask for price

Fmoc-Gly-Ser(Psi(Me,Me)Pro)-OH
5-07045 1g Ask for price

Fmoc-Gly-Ser(Psi(Me,Me)Pro)-OH
5-07046 5g Ask for price

Fmoc-Gly-Thr[Psi(Me,Me)Pro]-OH
5-07049 1g Ask for price

Fmoc-Gly-Thr[Psi(Me,Me)Pro]-OH
5-07050 5g Ask for price

Fmoc-Ile-Ser[Psi(Me,Me)Pro]-OH
5-07051 1g Ask for price

Fmoc-Ile-Ser[Psi(Me,Me)Pro]-OH
5-07052 5g Ask for price

Fmoc-Ile-Thr[Psi(Me,Me)Pro]-OH
5-07053 1g Ask for price

Fmoc-Ile-Thr[Psi(Me,Me)Pro]-OH
5-07054 5g Ask for price

Fmoc-Leu-Ser[Psi(Me,Me)Pro]-OH
5-07055 1g Ask for price

Fmoc-Leu-Ser[Psi(Me,Me)Pro]-OH
5-07056 5g Ask for price

Fmoc-Leu-Thr[Psi(Me,Me)Pro]-OH
5-07059 1g Ask for price

Fmoc-Leu-Thr[Psi(Me,Me)Pro]-OH
5-07060 5g Ask for price

Fmoc-Met-Ser[Psi(Me,Me)Pro]-OH
5-07065 1g Ask for price

Fmoc-Met-Ser[Psi(Me,Me)Pro]-OH
5-07066 5g Ask for price

Fmoc-Phe-Thr[Psi(Me,Me)Pro]-OH
5-07067 1g Ask for price

Fmoc-Phe-Thr[Psi(Me,Me)Pro]-OH
5-07068 5g Ask for price

Fmoc-Phe-Ser[Psi(Me,Me)Pro]-OH
5-07069 1g Ask for price

Fmoc-Phe-Ser[Psi(Me,Me)Pro]-OH
5-07070 5g Ask for price

Fmoc-Val-Ser[Psi(Me,Me)Pro]-OH
5-07087 1g Ask for price

Fmoc-Val-Ser[Psi(Me,Me)Pro]-OH
5-07088 5g Ask for price

Fmoc-Val-Thr[Psi(Me,Me)Pro]-OH
5-07089 1g Ask for price

Fmoc-Val-Thr[Psi(Me,Me)Pro]-OH
5-07090 5g Ask for price

Fmoc-Ile-Thr(Psi(Me,Me)pro)-OH
B-3440.0001 1.0g
EUR 176
Description: Sum Formula: C28H34N2O6; CAS# [957780-52-8]