Sars-2 Antibody Test In Jefferson County Texas

Lab Reagents

Human IgG antibody Laboratories manufactures the sars-2 antibody test in jefferson county texas reagents distributed by Genprice. The Sars-2 Antibody Test In Jefferson County Texas reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars-2 products are available in stock. Specificity: Sars-2 Category: Antibody Group: Test In

Test In information

Anti-SARS-CoV-2 Antibody

A2061-50 50 µg
EUR 480

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Transferrin antibody (Texas Red)

60R-TR010TR 3 mg
EUR 565
Description: Rabbit polyclonal Transferrin antibody (Texas Red) conjugated

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

SARS CoV-2 PCR kit

PCR-H731-48R 48T
EUR 823

SARS CoV-2 PCR kit

PCR-H731-96R 96T
EUR 1113

Anti-SARS-CoV-2 Antibody (Clone# 6F10)

A2060-50 50 µg
EUR 480

Anti-SARS-CoV-2 Spike S1 Antibody

A3000-50 50 µg
EUR 419

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Streptavidin (Texas Red)

abx670355-1mg 1 mg
EUR 537
  • Shipped within 1 week.

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal SARS Matrix Antibody

APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Anti-SARS-E2 antibody

STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Monkey RBC antibody (Texas Red)

60R-RM001TR 3 mg
EUR 565
Description: Rabbit polyclonal Monkey RBC antibody (Texas Red) conjugated

Sheep RBC antibody (Texas Red)

60R-RR003tr 3 mg
EUR 565
Description: Rabbit polyclonal Sheep RBC antibody (Texas Red) conjugated

Mouse RBC antibody (Texas Red)

60R-RR005tr 3 mg
EUR 565
Description: Rabbit polyclonal Mouse RBC antibody (Texas Red) conjugated

Bovine RBC antibody (Texas Red)

60R-RR011TR 3 mg
EUR 565
Description: Rabbit polyclonal Bovine RBC antibody (Texas Red) conjugated

Cat RBC antibody (Texas Red)

60R-RR013TR 3 mg
EUR 565
Description: Rabbit polyclonal Cat RBC antibody (Texas Red) conjugated

Chicken RBC antibody (Texas Red)

60R-RR014TR 3 mg
EUR 565
Description: Rabbit polyclonal Chicken RBC antibody (Texas Red) conjugated

Dog RBC antibody (Texas Red)

60R-RR016TR 3 mg
EUR 565
Description: Rabbit polyclonal Dog RBC antibody (Texas Red) conjugated

Goat RBC antibody (Texas Red)

60R-RR018TR 3 mg
EUR 565
Description: Rabbit polyclonal Goat RBC antibody (Texas Red) conjugated

Hamster RBC antibody (Texas Red)

60R-RR022TR 3 mg
EUR 565
Description: Rabbit polyclonal Hamster RBC antibody (Texas Red) conjugated

Horse RBC antibody (Texas Red)

60R-RR024TR 3 mg
EUR 565
Description: Rabbit polyclonal Horse RBC antibody (Texas Red) conjugated

Human RBC antibody (Texas Red)

60R-RR025TR 3 mg
EUR 565
Description: Rabbit polyclonal Human RBC antibody (Texas Red) conjugated

Pig RBC antibody (Texas Red)

60R-RR028TR 3 mg
EUR 565
Description: Rabbit polyclonal Pig RBC antibody (Texas Red) conjugated

Turkey RBC antibody (Texas Red)

60R-RR031TR 3 mg
EUR 565
Description: Rabbit polyclonal Turkey RBC antibody (Texas Red) conjugated

CD19 antibody (PE-Texas Red)

61R-CD19cHUAPC 100 tests
EUR 349
Description: Mouse monoclonal CD19 antibody (PE-Texas Red)

CD8a antibody (PE-Texas Red)

61R-CD8abMSPETR 100 ug
EUR 553
Description: Rat monoclonal CD8a antibody (PE-Texas Red)

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

SARS-CoV-2 Antigen ELISA Kit

DEIA2020 96 tests
EUR 905
  • The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit

E4901-100 100 assays
EUR 753

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)

P1523-10 10 µg
EUR 156

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)

P1523-50 50 µg
EUR 551

SARS CoV-2 RT PCR kit

RTq-H731-100R 100T
EUR 1311

SARS CoV-2 RT PCR kit

RTq-H731-150R 150T
EUR 1787

SARS CoV-2 RT PCR kit

RTq-H731-50R 50T
EUR 963

Anti-SARS-CoV-2 NP Antibody (Clone# 11D5)

A2092-50 50 µg
EUR 480

Anti-SARS-CoV-2 NP Antibody (Clone# 4G1)

A2093-50 50 µg
EUR 480

SARS-CoV-2 Nucleoprotein IgG Antibody ELISA Kit

E4821-100 96 assays
EUR 1057

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

Guinea Pig RBC antibody (Texas Red)

60R-RR020TR 3 mg
EUR 565
Description: Rabbit polyclonal Guinea Pig RBC antibody (Texas Red) conjugated

SARS-CoV spike protein Antibody

abx023139-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS-CoV spike protein Antibody

abx023143-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated

A53978 100 µg
EUR 570.55
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated

A53979 100 µg
EUR 570.55
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated

A53980 100 µg
EUR 570.55
Description: reagents widely cited

Avidin protein (Texas Red)

65C-CE0112 2 mg
EUR 279
Description: Purified Avidin protein (Texas Red) from hen egg white

Streptavidin protein (Texas Red)

65C-CE0312 1 mg
EUR 326
Description: Purified homogeneous preparation of Streptavidin protein

Texas Red-DHPE: (1mg)

60027 1MG
EUR 195
Description: Minimum order quantity: 1 unit of 1MG

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

HAV antibody IgM ELISA test

75 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HAV antibody IgM

HEV antibody IgM ELISA test

92 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV antibody IgM

Brucella Antibody Rapid Test Kit

abx092069-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

Antibody ISOTYPING TEST KIT (OKSA11303)

OKSA11303 10 Tests
EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

SARS-CoV-2 Spike RBD protein antibody pair 1

CSB-EAP33245 1 pair
EUR 750
  • The recommended concentrations for analysis performance are 1ug/ml for the capture antibody and 0.42ug/ml for the detection antibody, respectively. The optimal dilutions should be determined experimentally by the researcher.
Description: This is a set of capture antibody and HRP-conjugated antbody for quantitative detection of SARS-CoV-2 Spike RBD protein for through solid phase sandwich ELISA.

Anti-CoV-2 & SARS-CoV S1 Antibody (Clone# CR3022)

A2103-200 200 µg
EUR 480

Anti-SARS-CoV-2 Spike S1 Antibody (Clone# 4C6)

A3001-50 50 µg
EUR 419

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

Goat anti Human IgG (Fab'2) (Texas Red)

43C-CJ0114 1 mg
EUR 368
Description: Goat anti Human IgG secondary antibody (Fab'2)

Goat anti Human IgG (Fab'2) (Texas Red)

43C-CJ0120 1 mg
EUR 368
Description: Goat anti Human IgG secondary antibody (Fab'2)

Goat anti Human IgM (Fab'2) (Texas Red)

43C-CJ0126 1 mg
EUR 368
Description: Goat anti Human IgM secondary antibody (Fab'2)

Goat anti Mouse IgG (Fab'2) (Texas Red)

43C-CJ0209 1 mg
EUR 433
Description: Goat anti Mouse IgG secondary antibody (Fab'2)

Goat anti Mouse IgG (Fab'2) (Texas Red)

43C-CJ0215 1 mg
EUR 439
Description: Goat anti Mouse IgG secondary antibody (Fab'2)

Goat anti Mouse IgM (Fab'2) (Texas Red)

43C-CJ0221 1 mg
EUR 449
Description: Goat anti Mouse IgM secondary antibody (Fab'2)

Goat anti Rat IgG (Fab'2) (Texas Red)

43C-CJ0313 1 mg
EUR 438
Description: Goat anti Rat IgG secondary antibody (Fab'2)

Goat anti Rat IgG (Fab'2) (Texas Red)

43C-CJ0319 1 mg
EUR 447
Description: Goat anti Rat IgG secondary antibody (Fab'2)

Goat anti Rabbit IgG (Fab'2) (Texas Red)

43C-CJ0408 1 mg
EUR 363
Description: Goat anti Rabbit IgG secondary antibody (Fab'2) (Texas Red)

Goat anti Rabbit IgG (Fab'2) (Texas Red)

43C-CJ0413 500 µL
EUR 283
Description: Goat anti Rabbit IgG secondary antibody (Fab'2) (Texas Red)

Sars sgRNA CRISPR Lentivector (Rat) (Target 2)

K7368703 1.0 ug DNA
EUR 154

Sars sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3355203 1.0 ug DNA
EUR 154

SARS sgRNA CRISPR Lentivector (Human) (Target 2)

K2089803 1.0 ug DNA
EUR 154

Coronavirus (SARS-CoV-2) PCR Detection Kit

K1460 100 Rxns
EUR 570
  • The kit includes: Non-Template Negative Control (NTC), COVID-19 Positive control (PTC), PCR Primer/ Probe set, 2X qPCR Master Mix, Rehydration Buffer and Reverse Transcription Mix
Description: Kit for detection of SARS-CoV-2 in respiratory specimens using Real-Time (RT-PCR).

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1537-10 10 µg
EUR 156

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1537-50 50 µg
EUR 530

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1539-10 10 µg
EUR 156

Recombinant SARS-CoV-2 Nucleoprotein (1-430)

P1539-50 50 µg
EUR 530

Recombinant SARS-CoV-2 3C-like Proteinase

P1550-10 10 μg
EUR 156

Recombinant SARS-CoV-2 3C-like Proteinase

P1550-50 50 μg
EUR 551

Recombinant SARS-CoV-2 Papain-like Protease

P1551-10 10 μg
EUR 156

Recombinant SARS-CoV-2 Papain-like Protease

P1551-50 50 μg
EUR 551

Coronavirus (SARS-CoV-2) PCR Detection Kit

K1460-100 100 Rxns Ask for price

SARS CoV-2 One-Step PCR kit

Oneq-H731-100R 100T
EUR 1610

SARS CoV-2 One-Step PCR kit

Oneq-H731-150R 150T
EUR 2205

SARS CoV-2 One-Step PCR kit

Oneq-H731-50R 50T
EUR 1175

HIV 1+2 Ab CE ELISA test

97 96T/Box Ask for price
  • Area of application: Blood Screening
Description: ELISA based test for quantitative detection of HIV 1+2 Ab CE

HIV 1+2 Ag/Ab ELISA test

98 96T/Box Ask for price
  • Area of application: Blood Screening
Description: ELISA based test for quantitative detection of HIV 1+2 Ag/Ab

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Sars sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7368707 1.0 ug DNA
EUR 167

Sars sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3355207 1.0 ug DNA
EUR 167

SARS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2089807 1.0 ug DNA
EUR 167

Anti-Fascin 2/FSCN2 Antibody

A07840-2 100ug/vial
EUR 294

Anti-EIF4A1/2/3 Antibody

A03922-2 100ug/vial
EUR 334

Anti-ErbB 2/ERBB2 Antibody

A00010-2 100ug/vial
EUR 334

Anti-Bcl-2/BCL2 Antibody

A00040-2 100ug/vial
EUR 334

Anti-Angiopoietin-2/ANGPT2 Antibody

A00370-2 100ug/vial
EUR 334

Goat anti-Mouse IgM Antibody (Texas Red)

abx401021-1mg 1 mg
EUR 398
  • Shipped within 1 week.

Goat anti-Mouse IgG1 Antibody (Texas Red)

abx401038-1mg 1 mg
EUR 634
  • Shipped within 1 week.

Goat anti-Mouse IgG2a Antibody (Texas Red)

abx401040-1mg 1 mg
EUR 634
  • Shipped within 1 week.

Goat anti-Mouse IgG2b Antibody (Texas Red)

abx401042-1mg 1 mg
EUR 634
  • Shipped within 1 week.

Goat anti-Human IgM Antibody (Texas Red)

abx401049-1mg 1 mg
EUR 398
  • Shipped within 1 week.

Mouse antibody for SARS coronavirus nucleoprotein

3851 100 ug
EUR 387.13
Description: This is purified Mouse monoclonal antibody against SARS coronavirus nucleoprotein for WB, ELISA.

Mouse antibody for SARS coronavirus nucleoprotein

3861 100 ug
EUR 387.13
Description: This is purified Mouse monoclonal antibody against SARS coronavirus nucleoprotein for WB, ELISA.