Sars Antigen Test Harrisburg Pa

Lab Reagents

Human IgG antibody Laboratories manufactures the sars antigen test harrisburg pa reagents distributed by Genprice. The Sars Antigen Test Harrisburg Pa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Antigen Group: Test Harrisburg

Test Harrisburg information

PSA (Prostate-specific antigen) ELISA test

8 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen)

Inactivated Bacillus Anthracis Protective Antigen PA 20

VAng-Lsx1534-50g 50 µg
EUR 1047
Description: Bacillus Anthracis Protective Antigen PA 20, native protein from B. anthracis.

Inactivated Bacillus Anthracis Protective Antigen PA 63

VAng-Lsx1535-500g 500 µg
EUR 1495
Description: Bacillus Anthracis Protective Antigen PA 63, native protein from B. anthracis.

PA-PEG-PA,2K

33-HO016016-2K
  • EUR 190.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SARS Surface Antigen (aa 1 - 1190) [His]

DAG1838 50 ug
EUR 1681

HBsAg hepatitis B surface antigen ELISA test

77 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBsAg hepatitis B surface antigen

HBeAg hepatitis B E antigen ELISA test

79 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBeAg hepatitis B E antigen

HEV-Ag hepatitis E antigen ELISA test

94 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV-Ag hepatitis E antigen

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

Human Streptococcus Pneumoniae (SP) Antigen Rapid Test Kit

abx092096-20tests 20 tests
EUR 398
  • Shipped within 5-12 working days.

PA Protein

30R-3422 1 mg
EUR 300
Description: Human Prealbumin

PA Antibody

1-CSB-PA395880EA01ILR
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA. Recognizes PA from Influenza A virus. This antibody is Unconjugated. Tested in the following application: ELISA

17-PA

B7151-10 10 mg
EUR 464

17-PA

B7151-50 50 mg
EUR 1746

PA 452

B7746-10 10 mg
EUR 438

PA 452

B7746-50 50 mg
EUR 1639

PA-824

A1736-100 100 mg
EUR 421
Description: PA-824, a bicyclic nitroimidazoles, is an anti-tuberculosis (TB) agent that exerts potent in vitro activity against Mycobacterium tuberculosis with the minimal inhibition concentration (MIC) ranging from 0.015 ?g/ml to 0.25 ?g/ml and remains actively against a wide range of isolates.

PA-824

A1736-25 25 mg
EUR 200
Description: PA-824, a bicyclic nitroimidazoles, is an anti-tuberculosis (TB) agent that exerts potent in vitro activity against Mycobacterium tuberculosis with the minimal inhibition concentration (MIC) ranging from 0.015 ?g/ml to 0.25 ?g/ml and remains actively against a wide range of isolates.

PA-824

A1736-5 5 mg
EUR 119
Description: PA-824, a bicyclic nitroimidazoles, is an anti-tuberculosis (TB) agent that exerts potent in vitro activity against Mycobacterium tuberculosis with the minimal inhibition concentration (MIC) ranging from 0.015 ?g/ml to 0.25 ?g/ml and remains actively against a wide range of isolates.

PA-824

A1736-5.1 10 mM (in 1mL DMSO)
EUR 167
Description: PA-824, a bicyclic nitroimidazoles, is an anti-tuberculosis (TB) agent that exerts potent in vitro activity against Mycobacterium tuberculosis with the minimal inhibition concentration (MIC) ranging from 0.015 ?g/ml to 0.25 ?g/ml and remains actively against a wide range of isolates.

(+)-JQ1 PA

HY-112789 50mg
EUR 865

PA-GFPmt

PVT14046 2 ug
EUR 703

TruStrip RDT Pig Albumin Rapid Test cards, 10/pk

RDT-7010-PA-10 1 Pk
EUR 171

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Avian Influenza Virus Antigen Rapid Test Kit (Colloidal gold)

abx092015-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Newcastle Disease Virus Antigen Rapid Test Kit (Colloidal gold)

abx092016-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Human Chlamydia Trachomatis Antigen Rapid Test Kit (Colloidal gold)

abx092049-20tests 20 tests
EUR 230
  • Shipped within 5-12 working days.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Protective Antigen (PA) of Bacillus anthracis (MMS_128), Peptide Aptamer, Biotinylated

AP-329-B 1 mg Ask for price

Protective Antigen (PA) of Bacillus anthracis (MMS_128), Peptide Aptamer, unlabeled

AP-329-U 5 mg Ask for price

Anthrax PA Antibody

24269-100ul 100ul
EUR 390

Prealbumin PA Antibody

48017-100ul 100ul
EUR 333

Prealbumin PA Antibody

48017-50ul 50ul
EUR 239

PA Polyclonal Antibody

A68242 100 µg
EUR 570.55
Description: fast delivery possible

mPEG-PA,1K

33-MF001016-1K
  • EUR 494.00
  • EUR 198.00
  • 5G
  • G
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-PA,2K

33-MF001016-2K
  • EUR 494.00
  • EUR 198.00
  • 5G
  • G
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PA- mCherry- C1

PVT10759 2 ug
EUR 301

PA- mCherry- N1

PVT10760 2 ug
EUR 301

Pretomanid (PA-824)

B3033-25 25 mg
EUR 313

Pretomanid (PA-824)

B3033-5 5 mg
EUR 115

Avian Influenza H5 Virus Antigen Rapid Test Kit (Colloidal gold)

abx092014-40tests 40 tests
EUR 488
  • Shipped within 5-12 working days.

Avian Influenza H7 Virus Antigen Rapid Test Kit (Colloidal gold)

abx092017-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

Protective Antigen (PA) of Bacillus anthracis (MMS_128), Peptide Aptamer, FITC labelled

AP-329-F 1 mg Ask for price

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

HBV-NRAg hepatitis B virus nucleic acid related antigen ELISA test

84 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBV-NRAg hepatitis B virus nucleic acid related antigen

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

PA (224–233), Influenza

5-01691 4 x 5mg Ask for price

PA Antibody, HRP conjugated

1-CSB-PA395880EB01ILR
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA. Recognizes PA from Influenza A virus. This antibody is HRP conjugated. Tested in the following application: ELISA

PA Antibody, FITC conjugated

1-CSB-PA395880EC01ILR
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA. Recognizes PA from Influenza A virus. This antibody is FITC conjugated. Tested in the following application: ELISA

PA Antibody, Biotin conjugated

1-CSB-PA395880ED01ILR
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PA. Recognizes PA from Influenza A virus. This antibody is Biotin conjugated. Tested in the following application: ELISA

B. Anthracis PA Antibody

abx021540-1mg 1 mg
EUR 732
  • Shipped within 5-10 working days.

B. Anthracis PA Antibody

abx021543-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.

B. Anthracis PA Antibody

abx021544-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.

B. Anthracis PA Antibody

abx021549-1mg 1 mg
EUR 732
  • Shipped within 5-10 working days.

Human PA ELISA Kit

EHP0061 96Tests
EUR 521

Bovine PA ELISA Kit

EBP0061 96Tests
EUR 521

Anserini PA ELISA Kit

EAP0061 96Tests
EUR 521

Canine PA ELISA Kit

ECP0061 96Tests
EUR 521

Goat PA ELISA Kit

EGTP0061 96Tests
EUR 521

Prealbumin PA Conjugated Antibody

C48017 100ul
EUR 397

Phosphatidic Acid (PA) Antibody

abx412097-1ml 1 ml
EUR 704
  • Shipped within 1 week.

Pimaric Acid (PA) Antibody

20-abx318889
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidic Acid (PA) Antibody

abx415729-1ml 1 ml
EUR 509
  • Shipped within 1 week.

PA (224-233), Influenza

HY-P1580 10mg
EUR 452

Porcine PA ELISA Kit

EPP0061 96Tests
EUR 521

Rat PA ELISA Kit

ERP0061 96Tests
EUR 521

Rabbit PA ELISA Kit

ERTP0061 96Tests
EUR 521

Mouse PA ELISA Kit

EMP0061 96Tests
EUR 521

pTriEx- mCherry- PA- Rac1

PVT10328 2 ug
EUR 266

Anti-PA alpha antibody

STJ94940 200 µl
EUR 197
Description: Rabbit polyclonal to PAKalpha.

Anti-PA alpha antibody

STJ94941 200 µl
EUR 197
Description: Rabbit polyclonal to PAKalpha.

Anti-PA alpha antibody

STJ94942 200 µl
EUR 197
Description: Rabbit polyclonal to PAKalpha.

Anti-PA beta antibody

STJ94945 200 µl
EUR 197
Description: Rabbit polyclonal to PAKbeta.

Anti-PA gamma antibody

STJ94946 200 µl
EUR 197
Description: Rabbit polyclonal to PAKgamma.

Anti-PA gamma antibody

STJ94947 200 µl
EUR 197
Description: Rabbit polyclonal to PAKgamma.

Anti-PA gamma antibody

STJ94948 200 µl
EUR 197
Description: Rabbit polyclonal to PAKgamma.

Anti-PA gamma antibody

STJ94949 200 µl
EUR 197
Description: Rabbit polyclonal to PAKgamma.

Anti-PA gamma antibody

STJ98304 100 µl
EUR 234
Description: Mouse monoclonal to PAKgamma.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)

80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein

abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.