Sars Antigen Test Is It Accurate

Lab Reagents

Human IgG antibody Laboratories manufactures the sars antigen test is it accurate reagents distributed by Genprice. The Sars Antigen Test Is It Accurate reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Antigen Group: Test Is

Test Is information

Accudenz 50g

AN7050 50 gm
EUR 204
Description: Cell Separation Media

Accudenz 500g

AN7050/BLK 500 gm
EUR 1117
Description: Cell Separation Media

Human IS(serum indoxyl sulfate) ELISA Kit

EH4913 96T
EUR 567.6
  • Detection range: 31.25-2000 ng/ml
  • Alias: IS/ indoxyl sulfate/ serum indoxyl sulfate
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75 ng/ml

SARS-Associated Coronavirus E recombinant antigen

00191-V-01mg 0,1 mg
EUR 267.5
  • Category: Antigens, SARS, Ag
Description: SARS-Associated Coronavirus E recombinant antigen a.a. 1-76.

SARS-Associated Coronavirus E recombinant antigen

00191-V-1000ug 1000 ug
EUR 1282.5
  • Category: Antigens, SARS, Ag
Description: SARS-Associated Coronavirus E recombinant antigen a.a. 1-76.

SARS-CoV-2 Antigen ELISA Kit

DEIA2020 96 tests
EUR 905
  • The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

PSA (Prostate-specific antigen) ELISA test

8 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen)

TruStrip RDT Canine distemper virus (hardpad disease) antigen rapid test card, results is 2-10 mins, 50 cards/pk

RV-501200-RDT 1 pk Ask for price

SARS Surface Antigen (aa 1 - 1190) [His]

DAG1838 50 ug
EUR 1681

HBsAg hepatitis B surface antigen ELISA test

77 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBsAg hepatitis B surface antigen

HBeAg hepatitis B E antigen ELISA test

79 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBeAg hepatitis B E antigen

HEV-Ag hepatitis E antigen ELISA test

94 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV-Ag hepatitis E antigen

TruStrip RDT Clenbuterol rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100010-RDT 1 pk Ask for price

TruStrip RDT Quinolone rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100020-RDT 1 pk Ask for price

TruStrip RDT Salbutamal rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100030-RDT 1 pk Ask for price

TruStrip RDT Chloramphenicol rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100040-RDT 1 pk
EUR 651

TruStrip RDT Sulfanethazine rapid test card, results is 2-10 mins, 50 cards/pk

DE-100100-RDT 1 pk Ask for price

TruStrip RDT Ractopamine rapid test strips, results is 2-10 mins, 50 strips/pk

DE-10020-RDT 1 pk Ask for price

TruStrip RDT Gentamicin rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100200-RDT 1 pk Ask for price

TruStrip RDT Streptomycin rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100210-RDT 1 pk Ask for price

TruStrip RDT Melamine rapid test strips, results is 2-10 mins, 50 cards/pk

DE-100270-RDT 1 pk Ask for price

TruStrip RDT Lincomycin rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100630-RDT 1 pk Ask for price

TruStrip RDT Kanamycin rapid test strips, results is 2-10 mins, 50 strips/pk

DE-850101-RDT 1 pk Ask for price

Human IS ELISA Kit

EHI0046 96Tests
EUR 521

Bovine IS ELISA Kit

EBI0046 96Tests
EUR 521

Canine IS ELISA Kit

ECI0046 96Tests
EUR 521

Chicken IS ELISA Kit

ECKI0046 96Tests
EUR 521

Anserini IS ELISA Kit

EAI0046 96Tests
EUR 521

Goat IS ELISA Kit

EGTI0046 96Tests
EUR 521

IS ELISA KIT|Human

EF007501 96 Tests
EUR 689

Rat IS ELISA Kit

ERI0046 96Tests
EUR 521

Sheep IS ELISA Kit

ESI0046 96Tests
EUR 521

Rabbit IS ELISA Kit

ERTI0046 96Tests
EUR 521

Mouse IS ELISA Kit

EMI0046 96Tests
EUR 521

Monkey IS ELISA Kit

EMKI0046 96Tests
EUR 521

Porcine IS ELISA Kit

EPI0046 96Tests
EUR 521

TruStrip RDT Nitrofuran (AOZ) rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100060-RDT 1 pk Ask for price

TruStrip RDT Nitrofuran (AHD rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100070-RDT 1 pk Ask for price

TruStrip RDT Nitrofuran (SEM) rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100075-RDT 1 pk Ask for price

TruStrip RDT Nitrofuran (AOZ) rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100080-RDT 1 pk
EUR 651

TruStrip RDT Malachite green rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100280-RDT 1 pk Ask for price

TruStrip RDT Aflatoxin B1 rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100290-RDT 1 pk Ask for price

TruStrip RDT Total Aflatoxins rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100300-RDT 1 pk Ask for price

TruStrip RDT Aflatoxin M1 rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100330-RDT 1 pk Ask for price

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

Bridge-It cAMP 50

122934 1 Kit
EUR 266

Bridge-It cAMP 96

122935 1 Kit
EUR 455

Bridge-It cAMP 384

122938 1 Kit
EUR 585

Bridge-It cAMP 100

122939 1 Kit
EUR 239

Bridge-It SAM 50

1-1-1003A 1 Kit
EUR 266

Bridge-It SAM 96

1-1-1003B 1 Kit
EUR 455

Bridge-It SAM 100

1-1-1004A 1 Kit
EUR 239

Bridge-It SAM 384

1-1-1004B 1 Kit
EUR 585

Cap-IT Capping Tool

GP619 ea
EUR 97

Human Streptococcus Pneumoniae (SP) Antigen Rapid Test Kit

abx092096-20tests 20 tests
EUR 398
  • Shipped within 5-12 working days.

TruStrip RDT Sulfonamides residues (SAs) rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100090-RDT 1 pk
EUR 651

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Guinea Pig IS ELISA Kit

EGI0046 96Tests
EUR 521

Avian Influenza Virus Antigen Rapid Test Kit (Colloidal gold)

abx092015-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Newcastle Disease Virus Antigen Rapid Test Kit (Colloidal gold)

abx092016-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Human Chlamydia Trachomatis Antigen Rapid Test Kit (Colloidal gold)

abx092049-20tests 20 tests
EUR 230
  • Shipped within 5-12 working days.

Bridge-It L-Tryptophan 50

1-1-1001A 1 Kit
EUR 266

Bridge-It L-Tryptophan 96

1-1-1001B 1 Kit
EUR 455

Bridge-It L-Tryptophan 100

1-1-1002A 1 Kit
EUR 239

Bridge-It L-Tryptophan 384

1-1-1002B 1 Kit
EUR 585

Bridge-It L-MET 50

1-1-1005A 1 Kit
EUR 266

Bridge-It L-MET 96

1-1-1005B 1 Kit
EUR 455

Bridge-It L-MET 100

1-1-1006A 1 Kit
EUR 239

Bridge-It L-MET 384

1-1-1006B 1 Kit
EUR 585

Bridge-It cAMP-PDE 100

PD1007-100 1 Kit
EUR 239

Bridge-It cAMP-PDE 384

PD1007-384 1 Kit
EUR 585

Bridge-It cAMP-PDE 60

PD1016-60 1 Kit
EUR 266

Bridge-It cAMP-PDE 96

PD1016-96 1 Kit
EUR 455

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

TruStrip RDT Beta-Lactam and Tetracyclines rapid test strips, results is 2-10 mins, 50 strips/pk

DE-100260-RDT 1 pk Ask for price

Avian Influenza H5 Virus Antigen Rapid Test Kit (Colloidal gold)

abx092014-40tests 40 tests
EUR 488
  • Shipped within 5-12 working days.

Avian Influenza H7 Virus Antigen Rapid Test Kit (Colloidal gold)

abx092017-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

Poliomyelitis Virus IgG ELISA K it

DEIA372 96T
EUR 562
Description: The Poliomyelitis Virus IgG ELISA K it has been designed for the detection and the quantitative determination of specific IgG antibodies against Polio in serum and plasma.

TR-FRET Bridge-It SAM 50

TRF-1-1-1003A 1 Kit
EUR 288

TR-FRET Bridge-It SAM 96

TRF-1-1-1003B 1 Kit
EUR 482

TR-FRET Bridge-It SAM 100

TRF-1-1-1004A 1 Kit
EUR 239

TR-FRET Bridge-It SAM 384

TRF-1-1-1004B 1 Kit
EUR 617

TruStrip RDT Cow/Bovine Infectious rhinitis (IBR) antibody rapid test card, results is 2-10 mins, 50 cards/pk

RV-500300-RDT 1 pk Ask for price

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

Monoclonal KRT20 / CK20 / Cytokeratin 20 Antibody (clone IT-Ks 20.10, FITC), Clone: IT-Ks 20.10

AMM02054G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human KRT20 / CK20 / Cytokeratin 20 (clone IT-Ks 20.10, FITC). The antibodies are raised in Mouse and are from clone IT-Ks 20.10. This antibody is applicable in IHC-P, Flo

HBV-NRAg hepatitis B virus nucleic acid related antigen ELISA test

84 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBV-NRAg hepatitis B virus nucleic acid related antigen

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Human Serum Indoxyl Sulfate (IS) ELISA Kit

abx257961-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

pAd/BLOCK-iT-DEST RNAi Gateway Vector

PVT12297 2 ug
EUR 1119

TR-FRET Bridge-It L-Tryptophan 50

TRF-1-1-1001A 1 Kit
EUR 288

TR-FRET Bridge-It L-Tryptophan 96

TRF-1-1-1001B 1 Kit
EUR 482

TR-FRET Bridge-It L-Tryptophan 100

TRF-1-1-1002A 1 Kit
EUR 239

TR-FRET Bridge-It L-Tryptophan 384

TRF-1-1-1002B 1 Kit
EUR 617

TR-FRET Bridge-It L-MET 50

TRF-1-1-1005A 1 Kit
EUR 288

TR-FRET Bridge-It L-MET 96

TRF-1-1-1005B 1 Kit
EUR 482

TR-FRET Bridge-It L-MET 100

TRF-1-1-1006A 1 Kit
EUR 239

TR-FRET Bridge-It L-MET 384

TRF-1-1-1006B 1 Kit
EUR 617

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061