Sars Antigen Test Kit

Lab Reagents

Human IgG antibody Laboratories manufactures the sars antigen test kit reagents distributed by Genprice. The Sars Antigen Test Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Antigen Group: Test Kit

Test Kit information

SARS-Associated Coronavirus E recombinant antigen
00191-V-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antigens, SARS, Ag
Description: SARS-Associated Coronavirus E recombinant antigen a.a. 1-76.

PSA (Prostate-specific antigen) ELISA test
8	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen)

Human Streptococcus Pneumoniae (SP) Antigen Rapid Test Kit
abx092096-20tests	Abbexa	20 tests	EUR 398
Shipped within 5-12 working days.

SARS Surface Antigen (aa 1 - 1190) [His]
DAG1838	Creative Diagnostics	50 ug	EUR 1681

HBsAg hepatitis B surface antigen ELISA test
77	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBsAg hepatitis B surface antigen

HBeAg hepatitis B E antigen ELISA test
79	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBeAg hepatitis B E antigen

HEV-Ag hepatitis E antigen ELISA test
94	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV-Ag hepatitis E antigen

Avian Influenza Virus Antigen Rapid Test Kit (Colloidal gold)
abx092015-40tests	Abbexa	40 tests	EUR 432
Shipped within 5-12 working days.

Newcastle Disease Virus Antigen Rapid Test Kit (Colloidal gold)
abx092016-40tests	Abbexa	40 tests	EUR 432
Shipped within 5-12 working days.

Human Chlamydia Trachomatis Antigen Rapid Test Kit (Colloidal gold)
abx092049-20tests	Abbexa	20 tests	EUR 230
Shipped within 5-12 working days.

Avian Influenza H5 Virus Antigen Rapid Test Kit (Colloidal gold)
abx092014-40tests	Abbexa	40 tests	EUR 488
Shipped within 5-12 working days.

Avian Influenza H7 Virus Antigen Rapid Test Kit (Colloidal gold)
abx092017-40tests	Abbexa	40 tests	EUR 432
Shipped within 5-12 working days.

SARS ELISA KIT|Human
EF002719	Lifescience Market	96 Tests	EUR 689

SARS antibody
70R-20086	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody
70R-1444	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody
70R-1445	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody
39139-100ul	SAB	100ul	EUR 252

SARS Antibody
1-CSB-PA04145A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody
1-CSB-PA020709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA
20-abx904776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932473	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223-SARS
PVT12269	Lifescience Market	2 ug	EUR 391

Melamine Rapid Test Kit
abx092011-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

NDV rapid test kit
RG15-03	Bionote	1 box	EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-20tests	Accu test	20 tests	EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-40tests	Accu test	40 tests	EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SARS Coronavirus IgG ELISA Kit
DEIA1035	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit
DEIA1036	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS CoV-2 PCR kit
PCR-H731-48R	Bioingentech	48T	EUR 823

SARS CoV-2 PCR kit
PCR-H731-96R	Bioingentech	96T	EUR 1113

Tetrodotoxin (TTX) ELISA Test Kit
DEIANJ48	Creative Diagnostics	96T	EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Melamine (MEL) Rapid Test Kit
abx092057-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit
abx092058-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit
abx092059-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit
abx092060-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit
abx092063-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Sulfonamides (Sas) Rapid Test Kit
abx092064-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit
abx092065-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Ciprofloxacin (CPFX) Rapid Test Kit
abx092066-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit
abx092067-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Brucella Antibody Rapid Test Kit
abx092069-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

PCRAgH5 AIV Detection Test Kit
PD55-02	Bionote	1 kit	EUR 902.47
Description: Please check the datasheet of PCRAgH5 AIV Detection Test Kit before using the test.

Rapid Leishmania Ab Test Kit
RB2104	Bionote	1 box	EUR 127
Description: Please check the datasheet of Rapid Leishmania Ab Test Kit before using the test.

Rapid PED Ag Test Kit
RG14-01	Bionote	1 box	EUR 159.9
Description: Please check the datasheet of Rapid PED Ag Test Kit before using the test.

Antibody ISOTYPING TEST KIT (OKSA11303)
OKSA11303	Aviva Systems Biology	10 Tests	EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg	EnQuireBio	1mg	EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg	EnQuireBio	1mg	EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug	EnQuireBio	20ug	EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug	EnQuireBio	5ug	EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug	EnQuireBio	500ug	EUR 663

SARS Spike Antibody
24216-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24217-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24218-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24219-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24318-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24319-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24320-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24321-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24322-100ul	SAB	100ul	EUR 390

SARS Rabbit pAb
A13350-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A13350-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A13350-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A13350-50ul	Abclonal	50 ul	EUR 223

SARS Blocking Peptide
33R-8713	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide
33R-7048	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody
10R-1976	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody
10C-CR9003M1	Fitzgerald	100 ug	EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]
DAG1861	Creative Diagnostics	500 ug	EUR 2529

SARS S2 [His]
DAG1862	Creative Diagnostics	500 ug	EUR 2529

SARS-E2 Antibody
abx016055-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1720.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1970.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Conjugated Antibody
C39139	SAB	100ul	EUR 397

SARS cloning plasmid
CSB-CL020709HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb
A6733-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A6733-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A6733-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A6733-50ul	Abclonal	50 ul	EUR 223

SARS Polyclonal Antibody
A53977	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate
H-5982.0500	Bachem	0.5mg	EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000	Bachem	1.0mg	EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody
PAab07609	Lifescience Market	100 ug	EUR 386

Anti-SARS antibody
STJ28816	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)
YF-MA10816	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SARS

Human CD48(CD48 antigen) ELISA Kit
EH4332	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: B-lymphocyte activation marker BLAST-1/BCM1 surface antigen/Leukocyte antigen MEM-102/SLAM family member 2/SLAMF2/Signaling lymphocytic activation molecule 2/BLAST1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human CD81(CD81 antigen) ELISA Kit
EH7221	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human ALCAM(CD166 antigen) ELISA Kit
EH0001	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml Uniprot ID: Q13740 Alias: ALCAM/CD166/MEMD/activated leucocyte cell adhesion molecule/CD166 antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human CEA(Carcinoembryonic Antigen) ELISA Kit
EH0090	FN Test	96T	EUR 524.1
Detection range: 0.312-20 ng/ml Uniprot ID: P06731 Alias: CEA/Carcinoembryonic antigen/CD66E/CD66/CEACAM5/Carcinoembryonic Antigen-related Cell Adhesion Molecule 5/Meconium antigen 100
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CD276(CD276 antigen) ELISA Kit
EH0634	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Uniprot ID: Q5ZPR3 Alias: CD276/B7-H3/B7H3/B7 homolog 3/CD276 antigen/CD276 molecule/Costimulatory molecule
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human CD44(CD44 antigen) ELISA Kit
EH0654	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P16070 Alias: CD44/ECMR-III/HCAM/HCELL/LHR/MDU2/MDU3/MIC4/MUTCH-I/Pgp1/CD44R/CDw44/CSPG8/Epican/HUTCH-I/Hyaluronate receptor/IN/LHR/MC56/PGP-1/PGP-I/Phagocytic glycoprotein 1/Phagocytic glycoprotein I/IN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human CD109(CD109 antigen) ELISA Kit
EH1701	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q6YHK3 Alias: CD109/CPAMD7/150 kDa TGF-beta-1-binding protein/activated T-cell marker CD109/C3 and PZP-like alpha-2-macroglobulin domain-containing protein 7/CD109 antigen/CD109 molecule/CPAMD7r150/Gov plat Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CD177(CD177 antigen) ELISA Kit
EH1752	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q8N6Q3 Alias: CD177/CD177 antigen/Polycythemia rubra vera protein 1/PRV-1/Human neutrophil alloantigen 2a/HNA-2a/NB1 glycoprotein/NB1 GP/NB1/PRV1/HNA2A/PRV-1/HNA-2a/NB1 GP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Mouse Alcam(CD166 antigen) ELISA Kit
EM0324	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q61490 Alias: ALCAM/CD166/MEMD/activated leucocyte cell adhesion molecule/CD166 antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse CD44( CD44 antigen) ELISA Kit
EM0433	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P15379 Alias: CD44/ECMR-III/HCAM/HCELL/LHR/MDU2/MDU3/MIC4/MUTCH-I/Pgp1/CD44R/CDw44/CSPG8/Epican/HUTCH-I/Hyaluronate receptor/IN/LHR/MC56/PGP-1/PGP-I/Phagocytic glycoprotein 1/Phagocytic glycoprotein I/IN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat Alcam(CD166 antigen) ELISA Kit
ER0216	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O35112 Alias: ALCAM/CD166/MEMD/activated leucocyte cell adhesion molecule/CD166 antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Cd44(CD44 antigen) ELISA Kit
ER0342	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P26051 Alias: Cd44/ECMR-III/HCAM/HCELL/LHR/MDU2/MDU3/MIC4/MUTCH-I/Pgp1/CD44R/CDw44/CSPG8/Epican/HUTCH-I/Hyaluronate receptor/IN/LHR/MC56/PGP-1/PGP-I/Phagocytic glycoprotein 1/Phagocytic glycoprotein I/IN
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

DNASE TEST AGAR
D04-101-10kg	Alphabiosciences	10 kg	Ask for price

DNASE TEST AGAR
D04-101-2Kg	Alphabiosciences	2 Kg	Ask for price

DNASE TEST AGAR
D04-101-500g	Alphabiosciences	500 g	Ask for price

DERMATOPHYTE TEST AGAR
D04-107-10kg	Alphabiosciences	10 kg	EUR 849

DERMATOPHYTE TEST AGAR
D04-107-2Kg	Alphabiosciences	2 Kg	EUR 224

DERMATOPHYTE TEST AGAR
D04-107-500g	Alphabiosciences	500 g	EUR 97

MOTILITY TEST MEDIUM
M13-121-10kg	Alphabiosciences	10 kg	EUR 1528

MOTILITY TEST MEDIUM
M13-121-2Kg	Alphabiosciences	2 Kg	EUR 371

MOTILITY TEST MEDIUM
M13-121-500g	Alphabiosciences	500 g	EUR 137

SNYDER TEST AGAR
S19-119-10kg	Alphabiosciences	10 kg	EUR 1049

SNYDER TEST AGAR
S19-119-2Kg	Alphabiosciences	2 Kg	EUR 267

SNYDER TEST AGAR
S19-119-500g	Alphabiosciences	500 g	EUR 109

SAM Test Strip
TS00201s-30	Arthus	30 tests	EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip
TS00301s-30	Arthus	30 tests	EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip
TS00401s-30	Arthus	30 tests	EUR 553
Description: Serum homocysteine quantitative test strip

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

HBV-NRAg hepatitis B virus nucleic acid related antigen ELISA test
84	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBV-NRAg hepatitis B virus nucleic acid related antigen

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)
GEN-402-25tests	All test	25 tests	EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human CD5L(CD5 antigen-like) ELISA Kit
EH2229	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O43866 Alias: CD5L/AIM/API6/CT-2/SP-alpha/apoptosis inhibitor 6/CD5 antigen-like(scavenger receptor cysteine rich family)/CD5 molecule-like/IgM-associated peptide/PRO229/Spalpha/SP-ALPHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.156--10 ng/ml

Human TPA(Tissue Polypeptide Antigen) ELISA Kit
EH3901	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Alias: TPA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human LY75(Lymphocyte antigen 75) ELISA Kit
EH0299	FN Test	96T	EUR 524.1
Detection range: 31.2-2000 pg/ml Uniprot ID: O60449 Alias: C-type lectin domain family 13 member B/DEC-205/gp200-MR6/CD205
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 2pg/ml

Human MKI67(Antigen KI-67) ELISA Kit
EH0684	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P46013 Alias: MKI67/Antigen KI-67/Ki-67/KIA/TSG126/antigen identified by monoclonal Ki-67/KIA/proliferation-related Ki-67 antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CD52(CAMPATH-1 antigen) ELISA Kit
EH1286	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P31358 Alias: CD52(CAMPATH-1 antigen)/CDW52/HE5/Human epididymis-specific protein 5/Epididymal secretory protein E5/Cambridge pathology 1 antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CA50(Carbohydrate Antigen 50) ELISA Kit
EH1396	FN Test	96T	EUR 567.6
Detection range: 3.12-200 ng/ml Alias: CA50/Carbohydrate Antigen 50
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Mouse Ly6c1( Lymphocyte antigen 6C1) ELISA Kit
EM0555	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: P0CW02 Alias: Ly6c1/Ly-6C1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Mouse CD5l( CD5 antigen-like) ELISA Kit
EM0762	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: Q9QWK4 Alias: CD5l/AIM/API6/CT-2/SP-alpha/apoptosis inhibitor 6/CD5 antigen-like(scavenger receptor cysteine rich family)/CD5 molecule-like/IgM-associated peptide/PRO229/Spalpha/SP-ALPHA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Mouse CA125(Carbohydrate Antigen 125) ELISA Kit
EM0887	FN Test	96T	EUR 524.1
Detection range: 3.125-200IU/ml Alias: CA125/CA-125/MUC16/Mucin 16
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 1.875U/ml

Mouse PSA(Prostate Specific Antigen) ELISA Kit
EM1314	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q11011 Alias: PSA/Prostate Specific Antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse TPA(Tissue Polypeptide Antigen) ELISA Kit
EM1633	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Rat CA125(Carbohydrate Antigen 125) ELISA Kit
ER0788	FN Test	96T	EUR 524.1
Detection range: 7.813-500IU/ml Alias: CA125/CA-125/MUC16/Mucin 16
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 4.688U/ml

Rat PSA(Prostate Specific Antigen) ELISA Kit
ER1293	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Alias: PSA/KLK3/APS seminin/EC 3.4.21/EC 3.4.21.77/Gamma-seminoprotein/gamma-seminoprotein/hK3/kallikrein 3,(prostate specific antigen)/Kallikrein-3/kallikrein-3/kallikrein-related peptidase 3/KLK2A1/KLK3/P-30 antigen/ Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat TPA(Tissue Polypeptide Antigen) ELISA Kit
ER1398	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P19637 Alias: TPA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

SARS-CoV-2 IgG ELISA Kit
E4901-100	Biovision	100 assays	EUR 753

SARS CoV-2 RT PCR kit
RTq-H731-100R	Bioingentech	100T	EUR 1311

SARS CoV-2 RT PCR kit
RTq-H731-150R	Bioingentech	150T	EUR 1787

SARS CoV-2 RT PCR kit
RTq-H731-50R	Bioingentech	50T	EUR 963

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Clenbuterol Rapid Test Kit (Colloidal gold)
abx092040-50tests	Abbexa	50 tests	EUR 272
Shipped within 5-12 working days.

Ractopamine Rapid Test Kit (Colloidal gold)
abx092042-50tests	Abbexa	50 tests	EUR 300
Shipped within 5-12 working days.

Salbutamol Rapid Test Kit (Colloidal gold)
abx092043-50tests	Abbexa	50 tests	EUR 342
Shipped within 5-12 working days.

Chloramphenicol Rapid Test Kit (Colloidal gold)
abx092045-50tests	Abbexa	50 tests	EUR 356
Shipped within 5-12 working days.

Quinolones Rapid Test Kit (Colloidal gold)
abx092046-50tests	Abbexa	50 tests	EUR 537
Shipped within 5-12 working days.

Sulfonamides Rapid Test Kit (Colloidal gold)
abx092047-50tests	Abbexa	50 tests	EUR 551
Shipped within 5-12 working days.

Tetracycline Rapid Test Kit (Colloidal gold)
abx092048-50tests	Abbexa	50 tests	EUR 467
Shipped within 5-12 working days.

Zearalenone Rapid Test Kit (Colloidal gold)
abx092051-50tests	Abbexa	50 tests	EUR 411
Shipped within 5-12 working days.

Deoxynivalenol Rapid Test Kit (Colloidal gold)
abx092052-50tests	Abbexa	50 tests	EUR 467
Shipped within 5-12 working days.

Deoxynivalenol Rapid Test Kit (Colloidal gold)
abx092053-50tests	Abbexa	50 tests	EUR 467
Shipped within 5-12 working days.

Aflatoxin Rapid Test Kit (Colloidal gold)
abx092054-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Zearalenone Rapid Test Kit (Colloidal gold)
abx092056-50tests	Abbexa	50 tests	EUR 425
Shipped within 5-12 working days.

Goat Brucella Antibody Rapid Test Kit
abx092070-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Cow Brucella Antibody Rapid Test Kit
abx092071-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Pig Parvovirus Antibody Rapid Test Kit
abx092074-50tests	Abbexa	50 tests	EUR 321
Shipped within 5-12 working days.