Sars Antigen Test Nasal Swab Colliection

Lab Reagents

Human IgG antibody Laboratories manufactures the sars antigen test nasal swab colliection reagents distributed by Genprice. The Sars Antigen Test Nasal Swab Colliection reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Antigen Group: Test Nasal

Test Nasal information

PSA (Prostate-specific antigen) ELISA test
8 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PSA (Prostate-specific antigen)

Buccal Swab DNA Purification Kit
K1466-250 250 Preps
EUR 551

Buccal Swab DNA Purification Kit
K1466-50 50 Preps
EUR 318

SARS Surface Antigen (aa 1 - 1190) [His]
DAG1838 50 ug
EUR 1681

HBsAg hepatitis B surface antigen ELISA test
77 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBsAg hepatitis B surface antigen

HBeAg hepatitis B E antigen ELISA test
79 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBeAg hepatitis B E antigen

HEV-Ag hepatitis E antigen ELISA test
94 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV-Ag hepatitis E antigen

Sars/ Rat Sars ELISA Kit
ELI-41050r 96 Tests
EUR 886

One-Tube Swab DNA Extraction Kit
T71612 20Preps
EUR 66.75
  • Product category: Molecular Biology Kits/DNA - Extraction (Genomic)/Clinical

One-Tube Swab DNA Extraction Kit
T71613 100preps
EUR 99.48
  • Product category: Molecular Biology Kits/DNA - Extraction (Genomic)/Clinical

One-Tube Swab DNA Extraction Kit
T71614 500Preps, 500prep
EUR 247.93
  • Product category: Molecular Biology Kits/DNA - Extraction (Genomic)/Clinical

Human Streptococcus Pneumoniae (SP) Antigen Rapid Test Kit
abx092096-20tests 20 tests
EUR 398
  • Shipped within 5-12 working days.

SARS antibody
70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody
70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody
70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody
39139-100ul 100ul
EUR 252

SARS Antibody
1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody
1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA
20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA
20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA
20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS
PVT12269 2 ug
EUR 391

Avian Influenza Virus Antigen Rapid Test Kit (Colloidal gold)
abx092015-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Newcastle Disease Virus Antigen Rapid Test Kit (Colloidal gold)
abx092016-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

Human Chlamydia Trachomatis Antigen Rapid Test Kit (Colloidal gold)
abx092049-20tests 20 tests
EUR 230
  • Shipped within 5-12 working days.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Avian Influenza H5 Virus Antigen Rapid Test Kit (Colloidal gold)
abx092014-40tests 40 tests
EUR 488
  • Shipped within 5-12 working days.

Avian Influenza H7 Virus Antigen Rapid Test Kit (Colloidal gold)
abx092017-40tests 40 tests
EUR 432
  • Shipped within 5-12 working days.

AnaPrep HPV DNA Extraction Kit for swab samples
Z1322007 1 kit (48 extractions) Including all required plastic disposables
EUR 276
Description: This kit is developped for our fully automated magnetic bead-based nucleic acid extraction platform which uses preprogrammed protocols and can process up to 12 samples simultaneously. With the AnaPrep 12 Extractor you will have the option to choose and work with a wide range of sample and reagent volumes. This sturdy, realiable and user-friendly machine will save you both time and expenses while ensuring consistently high quality performance and nucleic acids for your downstream applications.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug 500ug
EUR 663

SARS Spike Antibody
24216-100ul 100ul
EUR 390

SARS Spike Antibody
24217-100ul 100ul
EUR 390

SARS Spike Antibody
24218-100ul 100ul
EUR 390

SARS Spike Antibody
24219-100ul 100ul
EUR 390

SARS Spike Antibody
24318-100ul 100ul
EUR 390

SARS Matrix Antibody
24319-100ul 100ul
EUR 390

SARS Matrix Antibody
24320-100ul 100ul
EUR 390

SARS Envelope Antibody
24321-100ul 100ul
EUR 390

SARS Envelope Antibody
24322-100ul 100ul
EUR 390

SARS Rabbit pAb
A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb
A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb
A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb
A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide
33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide
33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody
10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody
10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]
DAG1861 500 ug
EUR 2529

SARS S2 [His]
DAG1862 500 ug
EUR 2529

SARS-E2 Antibody
abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody
C39139 100ul
EUR 397

SARS cloning plasmid
CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb
A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb
A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb
A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb
A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody
A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate
H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody
PAab07609 100 ug
EUR 386

Anti-SARS antibody
STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)
YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

DNASE TEST AGAR
D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR
D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR
D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR
D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR
D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR
D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM
M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM
M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM
M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR
S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR
S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR
S19-119-500g 500 g
EUR 109

SAM Test Strip
TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip
TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip
TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

HBV-NRAg hepatitis B virus nucleic acid related antigen ELISA test
84 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBV-NRAg hepatitis B virus nucleic acid related antigen

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)
GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Nasal Embryonic Lhrh Factor Antibody
20-abx114026
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug
QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg
QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug
QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug
QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg
QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug
QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug
QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg
QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug
QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody
APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated
1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated
1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated
1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)
80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody
abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody
abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein
abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein
abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein
abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein
abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS ELISA KIT|Human
EF002719 96 Tests
EUR 689

Rat SARS shRNA Plasmid
20-abx988123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid
20-abx972567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody
APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid
20-abx954245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-SARS-E2 (4A6C9)
LF-MA30016 100 ul
EUR 344
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)
LF-MA30017 100 ul
EUR 354
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)
RP027604 100 ug Ask for price

SARS Recombinant Protein (Human)
RP027607 100 ug Ask for price

SARS Recombinant Protein (Rat)
RP227480 100 ug Ask for price

SARS Recombinant Protein (Mouse)
RP170009 100 ug Ask for price

SARS Recombinant Protein (Mouse)
RP170012 100 ug Ask for price

Anti-SARS-E2 antibody
STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody
STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein
VAng-Lsx0059-inquire inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

TruStrip RDT Anthrax Protective antigen 83 (PA83) Rapid Test cards, 25/pk
800-100-RDT-25 1 pk
EUR 408

Recombinant human RHD antigen 
P1958 100ug Ask for price
  • Uniprot ID: T2DL33
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human RHD antigen 

CA72-4 ELISA test
24 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA72-4

FERR ( Ferritin) ELISA test
7 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FERR ( Ferritin)

TSH (Thyrotrophin) ELISA test
14 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of TSH (Thyrotrophin)

T3 (Triiodothyronine) ELISA test
15 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T3 (Triiodothyronine)

T4 (Thyroxine) ELISA test
16 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of T4 (Thyroxine)

TESTO (Testosterone) ELISA test
19 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of O (osterone)

PROG (Progesterone) ELISA test
20 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PROG (Progesterone)

E2 (Estradiol) ELISA test
5 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of E2 (Estradiol)

PRL (Prolactin) ELISA test
4 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of PRL (Prolactin)

Basic Cytotoxicity Test Kits
CT17001 125 Tests
EUR 409

Basic Cytotoxicity Test Kits
CT17002 250 Tests
EUR 650

Total Cytotoxicity Test Kits
CT17003 125 Tests
EUR 513

Total Cytotoxicity Test Kits
CT17004 250 Tests
EUR 813

Clearview Chlamydia MF test
CV504524 1 box
EUR 162
Description: Please check the datasheet of Clearview Chlamydia MF test before using the test.

PreS2-Ag ELISA test
96 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of PreS2-Ag

HBcAb Sandwich ELISA test
95 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HBcAb Sandwich

Melamine Rapid Test Kit
abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

NDV rapid test kit
RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

IBD rapid test strip
RG15-04 10 boxes
EUR 148
Description: Please check the datasheet of IBD rapid test strip before using the test.

Rabies rapid test strip
RG18-01 10 boxes
EUR 151.92
Description: Please check the datasheet of Rabies rapid test strip before using the test.

Immortalized Human Nasal Epithelial Cells - SV40
T0440 1x106 cells / 1.0 ml Ask for price

Recombinant human Lymphocyte antigen 6K
P2272 100ug Ask for price
  • Uniprot ID: Q17RY6
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Lymphocyte antigen 6K

Recombinant SARS Associated Coronavirus Matrix
7-07114 100µg Ask for price

Recombinant SARS Associated Coronavirus Matrix
7-07115 500µg Ask for price

Recombinant SARS Associated Coronavirus Matrix
7-07116 1000µg Ask for price

Recombinant SARS Associated Coronavirus Envelope
7-07117 100µg Ask for price

Recombinant SARS Associated Coronavirus Envelope
7-07118 500µg Ask for price

Recombinant SARS Associated Coronavirus Envelope
7-07119 1000µg Ask for price

SARS Coronavirus IgG ELISA Kit
DEIA1035 96T
EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit
DEIA1036 96T
EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS-CoV spike protein Antibody
abx023139-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS-CoV spike protein Antibody
abx023143-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Matrix Protein
20-abx260150
  • EUR 885.00
  • EUR 342.00
  • EUR 1372.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Associated Coronavirus Envelope Protein
20-abx260151
  • EUR 885.00
  • EUR 342.00
  • EUR 1372.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated
A53978 100 µg
EUR 570.55
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated
A53979 100 µg
EUR 570.55
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated
A53980 100 µg
EUR 570.55
Description: reagents widely cited