Sars Antigent Test Near Me Lab Corp

Lab Reagents

Human IgG antibody Laboratories manufactures the sars antigent test near me lab corp reagents distributed by Genprice. The Sars Antigent Test Near Me Lab Corp reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Antigent Group: Test Near

Test Near information

LAB (pY136) Antibody

abx216527-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

NTAL/LAB Blocking Peptide

3838BP-50
EUR 153

LAB (Phospho-Tyr136) Antibody

12607-100ul 100ul
EUR 252

LAB (Phospho-Tyr136) Antibody

12607-50ul 50ul
EUR 187

Phospho-LAB (Tyr136) Antibody

AF8278 200ul
EUR 376
Description: LAB (Phospho-Tyr136) Antibody detects endogenous levels of LAB only when phosphorylated at Tyr136.

LAB (Phospho- Tyr136) Antibody

ABF8278 100 ug
EUR 438

Recombinant mouse NTAL / LAB

EXB0010 0.1 mg
EUR 304

Bangs Lab Bead Solution

SOLN1-1000 1000 ML
EUR 155.06
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres

Bangs Lab Bead Solution

SOLN1-2000 2000 ML
EUR 212.7
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres

Bangs Lab Bead Solution

SOLN1-500 500 ML
EUR 98.51
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres

N-Me-Tyr(Me)-OH

E-2160.0250 250.0mg
EUR 139
Description: Sum Formula: C11H15NO3; CAS# [52939-33-0]

N-Me-Tyr(Me)-OH

E-2160.1000 1.0g
EUR 368
Description: Sum Formula: C11H15NO3; CAS# [52939-33-0]

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

Lab Printer 26' Cassette of 12mm lab tape, blue w/ white print

L9010-12BW 1/pack
EUR 70.25
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 12mm lab tape, clear w/ black print

L9010-12CK 1/pack
EUR 75.92
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 12mm lab tape, green w/ white print

L9010-12GW 1/pack
EUR 70.25
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 12mm lab tape, red w/ white print

L9010-12RW 1/pack
EUR 70.25
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 12mm lab tape, white w/ black print

L9010-12WK 1/pack
EUR 74.3
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 12mm lab tape, yellow w/ black print

L9010-12YK 1/pack
EUR 70.25
  • w w/ black print
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 18mm lab tape, white w/ black print

L9010-18WK 1/pack
EUR 73.09
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 24mm lab tape, clear w/ black print

L9010-24CK 1/pack
EUR 83.21
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 24mm lab tape, white w/ black print

L9010-24WK 1/pack
EUR 79.97
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 6mm lab tape, clear w/ black print

L9010-6CK 1/pack
EUR 72.68
Description: Replacement Cartridge for Label Printers

Lab Printer 26' Cassette of 6mm lab tape, white w/ black print

L9010-6WK 1/pack
EUR 71.87
Description: Replacement Cartridge for Label Printers

Fmoc-N-Me-Ser(Me)-OH

5-05477 1g Ask for price

Fmoc-N-Me-Ser(Me)-OH

5-05478 5g Ask for price

Lab-Lemco Powder (Beef Extract)

abx082172-500g 500 g
EUR 342
  • Shipped within 5-10 working days.

Phospho-LAB (Tyr136) Blocking Peptide

AF8278-BP 1mg
EUR 195

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

ME-0328

2751-25
EUR 675

ME-0328

2751-5
EUR 207

DCPLA-ME

HY-108599A 10mM/1mL
EUR 492

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)

80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein

abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS ELISA KIT|Human

EF002719 96 Tests
EUR 689

Rat SARS shRNA Plasmid

20-abx988123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid

20-abx972567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody

APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid

20-abx954245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-SARS-E2 (4A6C9)

LF-MA30016 100 ul
EUR 344
Description: Mouse Monoclonal to SARS-E2

anti-SARS-M (2H2C4)

LF-MA30017 100 ul
EUR 354
Description: Mouse Monoclonal to SARS-M

SARS Recombinant Protein (Human)

RP027604 100 ug Ask for price

SARS Recombinant Protein (Human)

RP027607 100 ug Ask for price

SARS Recombinant Protein (Rat)

RP227480 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170009 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170012 100 ug Ask for price

Anti-SARS-E2 antibody

STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Recombinant SARS Matrix Protein

VAng-Lsx0059-inquire inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

EconoTek HRP Anti-Polyvalent Lab Pack

EHP125 1250 Slides
EUR 263

EconoTek HRP Anti-Polyvalent Lab Pack

EHP500 5000 Slides
EUR 642

EconoTek HRP Anti-Polyvalent Lab Pack

EHP999 10000 Slides
EUR 1084

LAB (Phospho-Tyr136) Polyclonal Conjugated Antibody

C12607 100ul
EUR 397

Retrieval HRP Anti-Polyvalent Lab Pack

RLP015 150 Slides
EUR 197

Retrieval HRP Anti-Polyvalent Lab Pack

RLP125 1250 Slides
EUR 607

Retrieval HRP Anti-Polyvalent Lab Pack

RLP500 5000 Slides
EUR 1439

Retrieval HRP Anti-Polyvalent Lab Pack

RLP999 10000 Slides
EUR 2552

SensiTek HRP Anti-Mouse Lab Pack

SHM125 1250 Slides
EUR 309

SensiTek HRP Anti-Mouse Lab Pack

SHM500 5000 Slides
EUR 754

SensiTek HRP Anti-Mouse Lab Pack

SHM999 10000 Slides
EUR 1311

SensiTek HRP Anti-Polyvalent Lab Pack

SHP125 1250 Slides
EUR 317

SensiTek HRP Anti-Polyvalent Lab Pack

SHP500 5000 Slides
EUR 828

SensiTek HRP Anti-Polyvalent Lab Pack

SHP999 10000 Slides
EUR 1471

SensiTek HRP Anti-Rabbit Lab Pack

SHR125 1250 Slides
EUR 309

SensiTek HRP Anti-Rabbit Lab Pack

SHR500 5000 Slides
EUR 754

SensiTek HRP Anti-Rabbit Lab Pack

SHR999 10000 Slides
EUR 1311

UltraTek HRP Anti-Mouse Lab Pack

UHM125 1250 Slides
EUR 402

UltraTek HRP Anti-Mouse Lab Pack

UHM500 5000 Slides
EUR 1033

UltraTek HRP Anti-Mouse Lab Pack

UHM999 10000 Slides
EUR 1755

UltraTek HRP Anti-Polyvalent Lab Pack

UHP125 1250 Slides
EUR 521

UltraTek HRP Anti-Polyvalent Lab Pack

UHP500 5000 Slides
EUR 1277

UltraTek HRP Anti-Polyvalent Lab Pack

UHP999 10000 Slides
EUR 2399

UltraTek HRP Anti-Rabbit Lab Pack

UHR125 1250 Slides
EUR 402

UltraTek HRP Anti-Rabbit Lab Pack

UHR500 5000 Slides
EUR 1033

UltraTek HRP Anti-Rabbit Lab Pack

UHR999 10000 Slides
EUR 1755

Power supply for LABeler Lab Printer

L9010-PS 1/pack
EUR 83.6
Description: Power supply for Labeler

Polyclonal OTUD4 Antibody (C-Term, near)

APG00577G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human OTUD4 (C-Term, near). This antibody is tested and proven to work in the following applications:

Polyclonal UHMK1 Antibody (C-Terminus, near)

APG00599G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UHMK1 (C-Terminus, near). This antibody is tested and proven to work in the following applications: