Lab Reagents
Human IgG antibody Laboratories manufactures the sars antigent test near me lab corp reagents distributed by Genprice. The Sars Antigent Test Near Me Lab Corp reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Antigent Group: Test Near
Test Near information
LAB (pY136) Antibody |
|
abx216527-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
SARS antibody |
|
70R-20086 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal SARS antibody |
SARS antibody |
|
70R-1444 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS |
SARS antibody |
|
70R-1445 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS |
SARS antibody |
|
39139-100ul |
SAB |
100ul |
EUR 252 |
SARS Antibody |
|
1-CSB-PA04145A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
SARS Antibody |
|
1-CSB-PA020709GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
SARS siRNA |
|
20-abx904776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SARS siRNA |
|
20-abx932473 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SARS siRNA |
|
20-abx932474 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Accu-Tell COVID-19 IgG/IgM Rapid Test |
|
GEN-B352-20tests |
Accu test |
20 tests |
EUR 236 |
|
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus. |
Accu-Tell COVID-19 IgG/IgM Rapid Test |
|
GEN-B352-40tests |
Accu test |
40 tests |
EUR 321 |
|
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus. |
NTAL/LAB Blocking Peptide |
|
3838BP-50 |
Biovision |
|
EUR 153 |
LAB (Phospho-Tyr136) Antibody |
|
12607-100ul |
SAB |
100ul |
EUR 252 |
LAB (Phospho-Tyr136) Antibody |
|
12607-50ul |
SAB |
50ul |
EUR 187 |
Phospho-LAB (Tyr136) Antibody |
|
AF8278 |
Affbiotech |
200ul |
EUR 376 |
|
Description: LAB (Phospho-Tyr136) Antibody detects endogenous levels of LAB only when phosphorylated at Tyr136. |
Recombinant mouse NTAL / LAB |
|
EXB0010 |
ExBio |
0.1 mg |
EUR 304 |
Bangs Lab Bead Solution |
|
SOLN1-1000 |
Bangs Laboratories |
1000 ML |
EUR 155.06 |
|
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres |
Bangs Lab Bead Solution |
|
SOLN1-2000 |
Bangs Laboratories |
2000 ML |
EUR 212.7 |
|
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres |
Bangs Lab Bead Solution |
|
SOLN1-500 |
Bangs Laboratories |
500 ML |
EUR 98.51 |
|
Description: Bangs Lab Bead Solution is ready-to-use solution and is suitable for dilution and/or storage of plain, dyed, or functionalized polymer microspheres |
N-Me-Tyr(Me)-OH |
|
E-2160.0250 |
Bachem |
250.0mg |
EUR 139 |
|
Description: Sum Formula: C11H15NO3; CAS# [52939-33-0] |
N-Me-Tyr(Me)-OH |
|
E-2160.1000 |
Bachem |
1.0g |
EUR 368 |
|
Description: Sum Formula: C11H15NO3; CAS# [52939-33-0] |
Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug |
|
QP13416-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg |
|
QP13416-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug |
|
QP13416-500ug |
EnQuireBio |
500ug |
EUR 663 |
Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug |
|
QP13417-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg |
|
QP13417-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug |
|
QP13417-500ug |
EnQuireBio |
500ug |
EUR 663 |
Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug |
|
QP13418-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg |
|
QP13418-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug |
|
QP13418-500ug |
EnQuireBio |
500ug |
EUR 663 |
Recombinant SARS SARS MERS Protein, His, E.coli-100ug |
|
QP13419-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS MERS Protein, His, E.coli-1mg |
|
QP13419-1mg |
EnQuireBio |
1mg |
EUR 1261 |
Recombinant SARS SARS MERS Protein, His, E.coli-500ug |
|
QP13419-500ug |
EnQuireBio |
500ug |
EUR 663 |
Recombinant SARS SARS-CoV Protein, His, E.coli-1mg |
|
QP13423-1mg |
EnQuireBio |
1mg |
EUR 3954 |
Recombinant SARS SARS-CoV Protein, His, E.coli-20ug |
|
QP13423-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant SARS SARS-CoV Protein, His, E.coli-5ug |
|
QP13423-5ug |
EnQuireBio |
5ug |
EUR 155 |
Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug |
|
QP10499-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg |
|
QP10499-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug |
|
QP10499-500ug |
EnQuireBio |
500ug |
EUR 663 |
SARS Spike Antibody |
|
24216-100ul |
SAB |
100ul |
EUR 390 |
SARS Spike Antibody |
|
24217-100ul |
SAB |
100ul |
EUR 390 |
SARS Spike Antibody |
|
24218-100ul |
SAB |
100ul |
EUR 390 |
SARS Spike Antibody |
|
24219-100ul |
SAB |
100ul |
EUR 390 |
SARS Spike Antibody |
|
24318-100ul |
SAB |
100ul |
EUR 390 |
SARS Matrix Antibody |
|
24319-100ul |
SAB |
100ul |
EUR 390 |
SARS Matrix Antibody |
|
24320-100ul |
SAB |
100ul |
EUR 390 |
SARS Envelope Antibody |
|
24321-100ul |
SAB |
100ul |
EUR 390 |
SARS Envelope Antibody |
|
24322-100ul |
SAB |
100ul |
EUR 390 |
SARS Rabbit pAb |
|
A13350-100ul |
Abclonal |
100 ul |
EUR 308 |
SARS Rabbit pAb |
|
A13350-200ul |
Abclonal |
200 ul |
EUR 459 |
SARS Rabbit pAb |
|
A13350-20ul |
Abclonal |
20 ul |
EUR 183 |
SARS Rabbit pAb |
|
A13350-50ul |
Abclonal |
50 ul |
EUR 223 |
SARS Blocking Peptide |
|
33R-8713 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445 |
SARS Blocking Peptide |
|
33R-7048 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444 |
SARS E2 antibody |
|
10R-1976 |
Fitzgerald |
100 ul |
EUR 241 |
|
Description: Mouse monoclonal SARS E2 antibody |
SARS M antibody |
|
10R-1977 |
Fitzgerald |
100 ul |
EUR 241 |
|
Description: Mouse monoclonal SARS M antibody |
SARS Coronavirus antibody |
|
10C-CR9003M1 |
Fitzgerald |
100 ug |
EUR 499 |
|
Description: Mouse monoclonal SARS Coronavirus antibody |
SARS Nucleocapsid antibody |
|
10R-10470 |
Fitzgerald |
100 ug |
EUR 435 |
|
Description: Mouse monoclonal SARS Nucleocapsid antibody |
SARS Nucleocapsid antibody |
|
10R-10471 |
Fitzgerald |
100 ug |
EUR 435 |
|
Description: Mouse monoclonal SARS Nucleocapsid antibody |
SARS-E2 Antibody |
|
abx016055-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
SARS-M Antibody |
|
abx016056-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
SARS Spike Antibody |
|
20-abx137184 |
Abbexa |
-
EUR 1052.00
-
EUR 1539.00
-
EUR 1720.00
|
|
- Shipped within 5-10 working days.
|
SARS Nucleocapsid Antibody |
|
20-abx137185 |
Abbexa |
-
EUR 1052.00
-
EUR 1539.00
-
EUR 1970.00
|
|
- Shipped within 5-10 working days.
|
SARS Spike Antibody |
|
20-abx137200 |
Abbexa |
-
EUR 1177.00
-
EUR 1887.00
-
EUR 2221.00
|
|
- Shipped within 5-10 working days.
|
SARS Nucleocapsid Antibody |
|
20-abx137201 |
Abbexa |
-
EUR 1177.00
-
EUR 1887.00
-
EUR 2221.00
|
|
- Shipped within 5-10 working days.
|
SARS Conjugated Antibody |
|
C39139 |
SAB |
100ul |
EUR 397 |
SARS cloning plasmid |
|
CSB-CL020709HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1545
- Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
- Show more
|
|
Description: A cloning plasmid for the SARS gene. |
SARS cloning plasmid |
|
CSB-CL020709HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1545
- Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
- Show more
|
|
Description: A cloning plasmid for the SARS gene. |
SARS Rabbit pAb |
|
A6733-100ul |
Abclonal |
100 ul |
EUR 308 |
SARS Rabbit pAb |
|
A6733-200ul |
Abclonal |
200 ul |
EUR 459 |
SARS Rabbit pAb |
|
A6733-20ul |
Abclonal |
20 ul |
EUR 183 |
SARS Rabbit pAb |
|
A6733-50ul |
Abclonal |
50 ul |
EUR 223 |
SARS Polyclonal Antibody |
|
A53977 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
SARS Protease Substrate |
|
H-5982.0500 |
Bachem |
0.5mg |
EUR 297 |
|
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net |
SARS Protease Substrate |
|
H-5982.1000 |
Bachem |
1.0mg |
EUR 515 |
|
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net |
Anti-SARS antibody |
|
STJ28816 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. |
Anti-SARS antibody |
|
STJ115313 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. |
Anti-SARS (1H4) |
|
YF-MA10816 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SARS |
Lab Printer 26' Cassette of 12mm lab tape, blue w/ white print |
|
L9010-12BW |
MTC Bio |
1/pack |
EUR 70.25 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 12mm lab tape, clear w/ black print |
|
L9010-12CK |
MTC Bio |
1/pack |
EUR 75.92 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 12mm lab tape, green w/ white print |
|
L9010-12GW |
MTC Bio |
1/pack |
EUR 70.25 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 12mm lab tape, red w/ white print |
|
L9010-12RW |
MTC Bio |
1/pack |
EUR 70.25 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 12mm lab tape, white w/ black print |
|
L9010-12WK |
MTC Bio |
1/pack |
EUR 74.3 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 12mm lab tape, yellow w/ black print |
|
L9010-12YK |
MTC Bio |
1/pack |
EUR 70.25 |
|
|
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 18mm lab tape, white w/ black print |
|
L9010-18WK |
MTC Bio |
1/pack |
EUR 73.09 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 24mm lab tape, clear w/ black print |
|
L9010-24CK |
MTC Bio |
1/pack |
EUR 83.21 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 24mm lab tape, white w/ black print |
|
L9010-24WK |
MTC Bio |
1/pack |
EUR 79.97 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 6mm lab tape, clear w/ black print |
|
L9010-6CK |
MTC Bio |
1/pack |
EUR 72.68 |
|
Description: Replacement Cartridge for Label Printers |
Lab Printer 26' Cassette of 6mm lab tape, white w/ black print |
|
L9010-6WK |
MTC Bio |
1/pack |
EUR 71.87 |
|
Description: Replacement Cartridge for Label Printers |
Lab-Lemco Powder (Beef Extract) |
|
abx082172-500g |
Abbexa |
500 g |
EUR 342 |
- Shipped within 5-10 working days.
|
Phospho-LAB (Tyr136) Blocking Peptide |
|
AF8278-BP |
Affbiotech |
1mg |
EUR 195 |
SAM Test Strip |
|
TS00201s-30 |
Arthus |
30 tests |
EUR 416 |
|
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood |
SAH Test Strip |
|
TS00301s-30 |
Arthus |
30 tests |
EUR 504 |
|
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood |
HCY Test Strip |
|
TS00401s-30 |
Arthus |
30 tests |
EUR 553 |
|
Description: Serum homocysteine quantitative test strip |
2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma) |
|
GEN-402-25tests |
All test |
25 tests |
EUR 244 |
|
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus. |
Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug |
|
QP13420-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg |
|
QP13420-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug |
|
QP13420-500ug |
EnQuireBio |
500ug |
EUR 663 |
Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug |
|
QP13421-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg |
|
QP13421-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug |
|
QP13421-500ug |
EnQuireBio |
500ug |
EUR 663 |
Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug |
|
QP13422-100ug |
EnQuireBio |
100ug |
EUR 218 |
Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg |
|
QP13422-1mg |
EnQuireBio |
1mg |
EUR 1061 |
Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug |
|
QP13422-500ug |
EnQuireBio |
500ug |
EUR 663 |
Polyclonal SARS Matrix Antibody |
|
APG02976G |
Leading Biology |
0.1 mg |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications: |
SARS Antibody, HRP conjugated |
|
1-CSB-PA04145B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SARS Antibody, FITC conjugated |
|
1-CSB-PA04145C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SARS Antibody, Biotin conjugated |
|
1-CSB-PA04145D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SARS protein (His tag) |
|
80R-2099 |
Fitzgerald |
50 ug |
EUR 322 |
|
Description: Recombinant human SARS protein (His tag) |
SARS N Protein Antibody |
|
abx018255-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
SARS N Protein Antibody |
|
abx018256-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
SARS virus Sn Antibody |
|
abx032683-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
SARS virus Sn Antibody |
|
abx032683-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SARS virus Sm Antibody |
|
abx032684-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
SARS virus Sm Antibody |
|
abx032684-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ACE2 (SARS Receptor) Antibody |
|
abx032686-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ACE2 (SARS Receptor) Antibody |
|
abx032686-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SARS CoV E Protein |
|
abx060650-1mg |
Abbexa |
1 mg |
EUR 1692 |
- Shipped within 5-10 working days.
|
SARS CoV Nucleocapsid Protein |
|
abx060652-1mg |
Abbexa |
1 mg |
EUR 1873 |
- Shipped within 5-10 working days.
|
SARS-CoV Nucleocapsid Protein |
|
abx060653-1mg |
Abbexa |
1 mg |
EUR 1692 |
- Shipped within 5-10 working days.
|
SARS-CoV Nucleocapsid Protein |
|
abx060654-1mg |
Abbexa |
1 mg |
EUR 1692 |
- Shipped within 5-10 working days.
|
SARS-CoV Spike Protein |
|
abx060655-1mg |
Abbexa |
1 mg |
EUR 1692 |
- Shipped within 5-10 working days.
|
Rat SARS shRNA Plasmid |
|
20-abx988123 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SARS shRNA Plasmid |
|
20-abx972567 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal SARS Matrix Antibody |
|
APR11178G |
Leading Biology |
0.1 mg |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications: |
Human SARS shRNA Plasmid |
|
20-abx954245 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
anti-SARS-E2 (4A6C9) |
|
LF-MA30016 |
Abfrontier |
100 ul |
EUR 344 |
|
Description: Mouse Monoclonal to SARS-E2 |
anti-SARS-M (2H2C4) |
|
LF-MA30017 |
Abfrontier |
100 ul |
EUR 354 |
|
Description: Mouse Monoclonal to SARS-M |
SARS Recombinant Protein (Human) |
|
RP027604 |
ABM |
100 ug |
Ask for price |
SARS Recombinant Protein (Human) |
|
RP027607 |
ABM |
100 ug |
Ask for price |
SARS Recombinant Protein (Rat) |
|
RP227480 |
ABM |
100 ug |
Ask for price |
SARS Recombinant Protein (Mouse) |
|
RP170009 |
ABM |
100 ug |
Ask for price |
SARS Recombinant Protein (Mouse) |
|
RP170012 |
ABM |
100 ug |
Ask for price |
Anti-SARS-E2 antibody |
|
STJ98377 |
St John's Laboratory |
100 µl |
EUR 234 |
|
Description: Mouse monoclonal to SARS-E2. |
Anti-SARS-M antibody |
|
STJ98378 |
St John's Laboratory |
100 µl |
EUR 234 |
|
Description: Mouse monoclonal to SARS-M. |
Recombinant SARS Matrix Protein |
|
VAng-Lsx0059-inquire |
Creative Biolabs |
inquire |
Ask for price |
|
Description: SARS Matrix, recombinant protein from E. coli. |
LAB (Phospho-Tyr136) Polyclonal Conjugated Antibody |
|
C12607 |
SAB |
100ul |
EUR 397 |
Power supply for LABeler Lab Printer |
|
L9010-PS |
MTC Bio |
1/pack |
EUR 83.6 |
|
Description: Power supply for Labeler |
Polyclonal OTUD4 Antibody (C-Term, near) |
|
APG00577G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human OTUD4 (C-Term, near). This antibody is tested and proven to work in the following applications: |
Polyclonal UHMK1 Antibody (C-Terminus, near) |
|
APG00599G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UHMK1 (C-Terminus, near). This antibody is tested and proven to work in the following applications: |
