Sars-Co-2 Antibody Test Kit Lepu Technology Medical Beijing Buy

Lab Reagents

Human IgG antibody Laboratories manufactures the sars-co-2 antibody test kit lepu technology medical beijing buy reagents distributed by Genprice. The Sars-Co-2 Antibody Test Kit Lepu Technology Medical Beijing Buy reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars-Co-2 products are available in stock. Specificity: Sars-Co-2 Category: Antibody Group: Test Kit

Test Kit information

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Anti-SARS-CoV-2 Antibody

A2061-50 50 µg
EUR 480

pCDH-CuO-MCS-IRES-GFP co-inducible IRES lentivector

QM530A-2 10 ug
EUR 679
  • Category: Lentiviral Technology

pCDH-CuO-MCS-IRES-RFP co-inducible IRES lentivector

QM531A-2 10 ug
EUR 679
  • Category: Lentiviral Technology

Myoglobin (Up-converting Phosphor Technology)

abx095254-80Units 80 Units
EUR 954
  • Shipped within 5-14 working days.

Procalcitonin (Up-converting Phosphor Technology)

abx095257-80Units 80 Units
EUR 1191
  • Shipped within 5-14 working days.

SARS-CoV-2 Antigen ELISA Kit

DEIA2020 96 tests
EUR 905
  • The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit

E4901-100 100 assays
EUR 753

SARS CoV-2 RT PCR kit

RTq-H731-100R 100T
EUR 1311

SARS CoV-2 RT PCR kit

RTq-H731-150R 150T
EUR 1787

SARS CoV-2 RT PCR kit

RTq-H731-50R 50T
EUR 963

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

SARS-CoV-2 Nucleoprotein IgG Antibody ELISA Kit

E4821-100 96 assays
EUR 1057

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Brucella Antibody Rapid Test Kit

abx092069-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

Antibody ISOTYPING TEST KIT (OKSA11303)

OKSA11303 10 Tests
EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

Influenza A H1N1 protein (Beijing)

30R-AI039 1 mg
EUR 1456
Description: Purified native Influenza A H1N1 protein (Beijing)

D-Dimer (Up-converting Phosphor Technology)

abx095256-80Units 80 Units
EUR 1316
  • Shipped within 5-14 working days.

Interleukin-6 (Up-converting Phosphor Technology)

abx095258-80Units 80 Units
EUR 1595
  • Shipped within 5-14 working days.

Coronavirus (SARS-CoV-2) PCR Detection Kit

K1460 100 Rxns
EUR 570
  • The kit includes: Non-Template Negative Control (NTC), COVID-19 Positive control (PTC), PCR Primer/ Probe set, 2X qPCR Master Mix, Rehydration Buffer and Reverse Transcription Mix
Description: Kit for detection of SARS-CoV-2 in respiratory specimens using Real-Time (RT-PCR).

Coronavirus (SARS-CoV-2) PCR Detection Kit

K1460-100 100 Rxns Ask for price

SARS CoV-2 One-Step PCR kit

Oneq-H731-100R 100T
EUR 1610

SARS CoV-2 One-Step PCR kit

Oneq-H731-150R 150T
EUR 2205

SARS CoV-2 One-Step PCR kit

Oneq-H731-50R 50T
EUR 1175

Nuclear Receptor Co-Repressor 2 (NCOR2) Antibody

20-abx133252
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-SARS-CoV-2 Antibody (Clone# 6F10)

A2060-50 50 µg
EUR 480

Anti-SARS-CoV-2 Spike S1 Antibody

A3000-50 50 µg
EUR 419

Co-1686

20-abx183952
  • EUR 356.00
  • EUR 523.00
  • 10 mg
  • 50 mg
  • Shipped within 1-2 weeks.

Co 102862

B7135-10 10 mg
EUR 276

Co 102862

B7135-50 50 mg
EUR 999

SARS ELISA KIT|Human

EF002719 96 Tests
EUR 689

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Melamine Rapid Test Kit

abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

NDV rapid test kit

RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal SARS Matrix Antibody

APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Anti-SARS-E2 antibody

STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Goat Brucella Antibody Rapid Test Kit

abx092070-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

Cow Brucella Antibody Rapid Test Kit

abx092071-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

Pig Parvovirus Antibody Rapid Test Kit

abx092074-50tests 50 tests
EUR 321
  • Shipped within 5-12 working days.

Rat Antibody ISOTYPING TEST KIT (OKSA11304)

OKSA11304 10 Tests
EUR 924
Description: Description of target: RAT MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Rat;Application: IS;Assay info: ;Sensitivity:

Colorectal Cancer Exosome

P141-CO NULL
EUR 0

Colorectal Cancer Exosome RNA

P241-CO NULL
EUR 0

Human Nuclear Receptor Co- Repressor 2 ELISA Kit

ELA-E11288h 96 Tests
EUR 824

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

pBbA5c-MevT(CO)-T1-MBIS(CO, ispA)

PVT17450 2 ug
EUR 300

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Creatine Kinase MB (Up-converting Phosphor Technology)

abx095253-80Units 80 Units
EUR 954
  • Shipped within 5-14 working days.

C-Reactive Protein (Up-converting Phosphor Technology)

abx095259-80Units 80 Units
EUR 954
  • Shipped within 5-14 working days.

SARS-CoV-2 IgG ELISA Kit 1-plate

K075-H1R 1-plate
EUR 552
Description: This K075-H1R SARS-CoV-2 IgG ELISA Kit 1-plate is only for Research Use Only (RUO), and is not to be used for diagnostic applications.

SARS-CoV-2 IgG ELISA Kit 5-plate

K075-H5R 5-plate
EUR 2054
Description: This K075-H5R SARS-CoV-2 IgG ELISA Kit 5-plate is only for Research Use Only (RUO), and is not to be used for diagnostic applications.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)

P1523-10 10 µg
EUR 156

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)

P1523-50 50 µg
EUR 551

Anti-SARS-CoV-2 NP Antibody (Clone# 11D5)

A2092-50 50 µg
EUR 480

Anti-SARS-CoV-2 NP Antibody (Clone# 4G1)

A2093-50 50 µg
EUR 480

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

SARS Coronavirus IgG ELISA Kit

DEIA1035 96T
EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit

DEIA1036 96T
EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

Anti-NY-CO-1 Antibody

A09039 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NY-CO-1 Antibody (NEMF) detection.tested for WB in Human, Mouse, Rat.

NY-CO-8 Polyclonal Antibody

ABP53557-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-8 from Human, Mouse. This NY-CO-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600

NY-CO-8 Polyclonal Antibody

ABP53557-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-8 from Human, Mouse. This NY-CO-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600

NY-CO-8 Polyclonal Antibody

ABP53557-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-8 from Human, Mouse. This NY-CO-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600

NY-CO-1 Polyclonal Antibody

ABP51994-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-1 from Human, Mouse, Rat. This NY-CO-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930

NY-CO-1 Polyclonal Antibody

ABP51994-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-1 from Human, Mouse, Rat. This NY-CO-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930

NY-CO-1 Polyclonal Antibody

ABP51994-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-1 from Human, Mouse, Rat. This NY-CO-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930

NY-CO-9 Polyclonal Antibody

ABP51995-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-9 from Human, Mouse, Rat. This NY-CO-9 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130

NY-CO-9 Polyclonal Antibody

ABP51995-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-9 from Human, Mouse, Rat. This NY-CO-9 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130

NY-CO-9 Polyclonal Antibody

ABP51995-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130
  • Applications tips:
Description: A polyclonal antibody for detection of NY-CO-9 from Human, Mouse, Rat. This NY-CO-9 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130

NY-CO-1 Polyclonal Antibody

ES2993-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NY-CO-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NY-CO-1 Polyclonal Antibody

ES2993-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NY-CO-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NY-CO-9 Polyclonal Antibody

ES2994-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NY-CO-9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NY-CO-9 Polyclonal Antibody

ES2994-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NY-CO-9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NY-CO-8 Polyclonal Antibody

ES4556-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NY-CO-8 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

NY-CO-8 Polyclonal Antibody

ES4556-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NY-CO-8 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Anti-NY-CO-1 antibody

STJ94580 200 µl
EUR 197
Description: Rabbit polyclonal to NY-CO-1.

Anti-NY-CO-8 antibody

STJ94581 200 µl
EUR 197
Description: Rabbit polyclonal to NY-CO-8.

Anti-NY-CO-9 antibody

STJ94582 200 µl
EUR 197
Description: Rabbit polyclonal to NY-CO-9.

CO-1686 (Rociletinib)

2794-25
EUR 675

CO-1686 (Rociletinib)

2794-5
EUR 207

Co 101244 hydrochloride

B7062-10 10 mg
EUR 334

Co 101244 hydrochloride

B7062-50 50 mg
EUR 1243

Co-Precipitant, Pink

BIO-37075 1.5ml, 5mg/ml Ask for price

Tetrodotoxin (TTX) ELISA Test Kit

DEIANJ48 96T
EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Melamine (MEL) Rapid Test Kit

abx092057-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit

abx092058-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit

abx092059-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit

abx092060-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit

abx092063-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Sulfonamides (Sas) Rapid Test Kit

abx092064-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit

abx092065-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Ciprofloxacin (CPFX) Rapid Test Kit

abx092066-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit

abx092067-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

PCRAgH5 AIV Detection Test Kit

PD55-02 1 kit
EUR 902.47
Description: Please check the datasheet of PCRAgH5 AIV Detection Test Kit before using the test.

Rapid Leishmania Ab Test Kit

RB2104 1 box
EUR 127
Description: Please check the datasheet of Rapid Leishmania Ab Test Kit before using the test.

Rapid PED Ag Test Kit

RG14-01 1 box
EUR 159.9
Description: Please check the datasheet of Rapid PED Ag Test Kit before using the test.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS-CoV spike protein Antibody

abx023139-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS-CoV spike protein Antibody

abx023143-100ug 100 ug
EUR 857
  • Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated

A53978 100 µg
EUR 570.55
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated

A53979 100 µg
EUR 570.55
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated

A53980 100 µg
EUR 570.55
Description: reagents widely cited

SARS-CoV-2 IgG ELISA Kit 1-plate EUA

K075-H1 1-plate
EUR 552
Description: This K075-H1 SARS-CoV-2 IgG ELISA Kit 1-plate EUA is only for certified clinical lab use only. The assay has been submitted for Emergency Use Authorization (EUA) through the US FDA. It has not been approved at the current time.

SARS-CoV-2 IgG ELISA Kit 5-plate EUA

K075-H5 5-plate
EUR 2054
Description: This K075-H5 SARS-CoV-2 IgG ELISA Kit 5-plate EUA is only for certified clinical lab use only. The assay has been submitted for Emergency Use Authorization (EUA) through the US FDA. It has not been approved at the current time.

Lipoprotein-associated phospholipase A2 (Up-converting Phosphor Technology)

abx095250-80Units 80 Units
EUR 1553
  • Shipped within 5-14 working days.

Cardiac Troponin I (cTnI) (Up-converting Phosphor Technology)

abx095252-80Units 80 Units
EUR 1316
  • Shipped within 5-14 working days.

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

Influenza A Virus H1N1 Beijing 262/95

7-07924 10µg Ask for price

Influenza A Virus H1N1 Beijing 262/95

7-07925 50µg Ask for price

Influenza A Virus H1N1 Beijing 262/95

7-07926 1mg Ask for price

Influenza A Virus (H1N1) Beijing 262/95

RP-1520 10 ug
EUR 225

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

HAV antibody IgM ELISA test

75 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HAV antibody IgM

HEV antibody IgM ELISA test

92 96T/Box Ask for price
  • Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV antibody IgM

Porcine Circovirus 2 Antibodies Rapid Test Kit (Colloidal gold)

abx092027-40tests 40 tests
EUR 321
  • Shipped within 5-12 working days.