Sars-Co-2 Antibody Test Kit Lepu Technology Medical Beijing Buy

Lab Reagents

Human IgG antibody Laboratories manufactures the sars-co-2 antibody test kit lepu technology medical beijing buy reagents distributed by Genprice. The Sars-Co-2 Antibody Test Kit Lepu Technology Medical Beijing Buy reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars-Co-2 products are available in stock. Specificity: Sars-Co-2 Category: Antibody Group: Test Kit

Test Kit information

SARS Antibody
1-CSB-PA04145A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody
1-CSB-PA020709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Anti-SARS-CoV-2 Antibody
A2061-50	Biovision	50 µg	EUR 480

pCDH-CuO-MCS-IRES-GFP co-inducible IRES lentivector
QM530A-2	SBI	10 ug	EUR 679
Category: Lentiviral Technology

pCDH-CuO-MCS-IRES-RFP co-inducible IRES lentivector
QM531A-2	SBI	10 ug	EUR 679
Category: Lentiviral Technology

Myoglobin (Up-converting Phosphor Technology)
abx095254-80Units	Abbexa	80 Units	EUR 954
Shipped within 5-14 working days.

Procalcitonin (Up-converting Phosphor Technology)
abx095257-80Units	Abbexa	80 Units	EUR 1191
Shipped within 5-14 working days.

SARS-CoV-2 Antigen ELISA Kit
DEIA2020	Creative Diagnostics	96 tests	EUR 905
The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit
E4901-100	Biovision	100 assays	EUR 753

SARS CoV-2 RT PCR kit
RTq-H731-100R	Bioingentech	100T	EUR 1311

SARS CoV-2 RT PCR kit
RTq-H731-150R	Bioingentech	150T	EUR 1787

SARS CoV-2 RT PCR kit
RTq-H731-50R	Bioingentech	50T	EUR 963

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

SARS-CoV-2 Nucleoprotein IgG Antibody ELISA Kit
E4821-100	Biovision	96 assays	EUR 1057

SARS Spike Antibody
24216-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24217-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24218-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24219-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24318-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24319-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24320-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24321-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24322-100ul	SAB	100ul	EUR 390

SARS E2 antibody
10R-1976	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody
10C-CR9003M1	Fitzgerald	100 ug	EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS-E2 Antibody
abx016055-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1720.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1970.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Conjugated Antibody
C39139	SAB	100ul	EUR 397

SARS Polyclonal Antibody
A53977	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Anti-SARS antibody
PAab07609	Lifescience Market	100 ug	EUR 386

Anti-SARS antibody
STJ28816	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Brucella Antibody Rapid Test Kit
abx092069-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Antibody ISOTYPING TEST KIT (OKSA11303)
OKSA11303	Aviva Systems Biology	10 Tests	EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

Influenza A H1N1 protein (Beijing)
30R-AI039	Fitzgerald	1 mg	EUR 1456
Description: Purified native Influenza A H1N1 protein (Beijing)

D-Dimer (Up-converting Phosphor Technology)
abx095256-80Units	Abbexa	80 Units	EUR 1316
Shipped within 5-14 working days.

Interleukin-6 (Up-converting Phosphor Technology)
abx095258-80Units	Abbexa	80 Units	EUR 1595
Shipped within 5-14 working days.

Coronavirus (SARS-CoV-2) PCR Detection Kit
K1460	Biovision	100 Rxns	EUR 570
The kit includes: Non-Template Negative Control (NTC), COVID-19 Positive control (PTC), PCR Primer/ Probe set, 2X qPCR Master Mix, Rehydration Buffer and Reverse Transcription Mix
Description: Kit for detection of SARS-CoV-2 in respiratory specimens using Real-Time (RT-PCR).

Coronavirus (SARS-CoV-2) PCR Detection Kit
K1460-100	Biovision	100 Rxns	Ask for price

SARS CoV-2 One-Step PCR kit
Oneq-H731-100R	Bioingentech	100T	EUR 1610

SARS CoV-2 One-Step PCR kit
Oneq-H731-150R	Bioingentech	150T	EUR 2205

SARS CoV-2 One-Step PCR kit
Oneq-H731-50R	Bioingentech	50T	EUR 1175

Nuclear Receptor Co-Repressor 2 (NCOR2) Antibody
20-abx133252	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Anti-SARS-CoV-2 Antibody (Clone# 6F10)
A2060-50	Biovision	50 µg	EUR 480

Anti-SARS-CoV-2 Spike S1 Antibody
A3000-50	Biovision	50 µg	EUR 419

Co-1686
20-abx183952	Abbexa	EUR 356.00 EUR 523.00	10 mg 50 mg
Shipped within 1-2 weeks.

Co 102862
B7135-10	ApexBio	10 mg	EUR 276

Co 102862
B7135-50	ApexBio	50 mg	EUR 999

SARS ELISA KIT|Human
EF002719	Lifescience Market	96 Tests	EUR 689

SARS siRNA
20-abx904776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932473	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223-SARS
PVT12269	Lifescience Market	2 ug	EUR 391

Melamine Rapid Test Kit
abx092011-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

NDV rapid test kit
RG15-03	Bionote	1 box	EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

Polyclonal SARS Matrix Antibody
APG02976G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated
1-CSB-PA04145B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated
1-CSB-PA04145C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated
1-CSB-PA04145D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS N Protein Antibody
abx018255-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS N Protein Antibody
abx018256-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SARS virus Sm Antibody
abx032684-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polyclonal SARS Matrix Antibody
APR11178G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Anti-SARS-E2 antibody
STJ98377	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody
STJ98378	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to SARS-M.

Goat Brucella Antibody Rapid Test Kit
abx092070-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Cow Brucella Antibody Rapid Test Kit
abx092071-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Pig Parvovirus Antibody Rapid Test Kit
abx092074-50tests	Abbexa	50 tests	EUR 321
Shipped within 5-12 working days.

Rat Antibody ISOTYPING TEST KIT (OKSA11304)
OKSA11304	Aviva Systems Biology	10 Tests	EUR 924
Description: Description of target: RAT MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Rat;Application: IS;Assay info: ;Sensitivity:

Colorectal Cancer Exosome
P141-CO	101Bio	NULL	EUR 0

Colorectal Cancer Exosome RNA
P241-CO	101Bio	NULL	EUR 0

Human Nuclear Receptor Co- Repressor 2 ELISA Kit
ELA-E11288h	Lifescience Market	96 Tests	EUR 824

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-20tests	Accu test	20 tests	EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-40tests	Accu test	40 tests	EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

pBbA5c-MevT(CO)-T1-MBIS(CO, ispA)
PVT17450	Lifescience Market	2 ug	EUR 300

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Creatine Kinase MB (Up-converting Phosphor Technology)
abx095253-80Units	Abbexa	80 Units	EUR 954
Shipped within 5-14 working days.

C-Reactive Protein (Up-converting Phosphor Technology)
abx095259-80Units	Abbexa	80 Units	EUR 954
Shipped within 5-14 working days.

SARS-CoV-2 IgG ELISA Kit 1-plate
K075-H1R	Arbor Assays	1-plate	EUR 552
Description: This K075-H1R SARS-CoV-2 IgG ELISA Kit 1-plate is only for Research Use Only (RUO), and is not to be used for diagnostic applications.

SARS-CoV-2 IgG ELISA Kit 5-plate
K075-H5R	Arbor Assays	5-plate	EUR 2054
Description: This K075-H5R SARS-CoV-2 IgG ELISA Kit 5-plate is only for Research Use Only (RUO), and is not to be used for diagnostic applications.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)
P1523-10	Biovision	10 µg	EUR 156

Recombinant Coronavirus Nucleoprotein (SARS-CoV-2)
P1523-50	Biovision	50 µg	EUR 551

Anti-SARS-CoV-2 NP Antibody (Clone# 11D5)
A2092-50	Biovision	50 µg	EUR 480

Anti-SARS-CoV-2 NP Antibody (Clone# 4G1)
A2093-50	Biovision	50 µg	EUR 480

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SARS Coronavirus IgG ELISA Kit
DEIA1035	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit
DEIA1036	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

Anti-NY-CO-1 Antibody
A09039	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for NY-CO-1 Antibody (NEMF) detection.tested for WB in Human, Mouse, Rat.

NY-CO-8 Polyclonal Antibody
ABP53557-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-8 from Human, Mouse. This NY-CO-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600

NY-CO-8 Polyclonal Antibody
ABP53557-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-8 from Human, Mouse. This NY-CO-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600

NY-CO-8 Polyclonal Antibody
ABP53557-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-8 from Human, Mouse. This NY-CO-8 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-8 at AA rangle: 520-600

NY-CO-1 Polyclonal Antibody
ABP51994-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-1 from Human, Mouse, Rat. This NY-CO-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930

NY-CO-1 Polyclonal Antibody
ABP51994-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-1 from Human, Mouse, Rat. This NY-CO-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930

NY-CO-1 Polyclonal Antibody
ABP51994-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-1 from Human, Mouse, Rat. This NY-CO-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-1 at AA range: 850-930

NY-CO-9 Polyclonal Antibody
ABP51995-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-9 from Human, Mouse, Rat. This NY-CO-9 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130

NY-CO-9 Polyclonal Antibody
ABP51995-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-9 from Human, Mouse, Rat. This NY-CO-9 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130

NY-CO-9 Polyclonal Antibody
ABP51995-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130 Applications tips:
Description: A polyclonal antibody for detection of NY-CO-9 from Human, Mouse, Rat. This NY-CO-9 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human NY-CO-9 at AA range: 1050-1130

NY-CO-1 Polyclonal Antibody
ES2993-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NY-CO-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NY-CO-1 Polyclonal Antibody
ES2993-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NY-CO-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NY-CO-9 Polyclonal Antibody
ES2994-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NY-CO-9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NY-CO-9 Polyclonal Antibody
ES2994-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NY-CO-9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NY-CO-8 Polyclonal Antibody
ES4556-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NY-CO-8 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

NY-CO-8 Polyclonal Antibody
ES4556-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NY-CO-8 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Anti-NY-CO-1 antibody
STJ94580	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to NY-CO-1.

Anti-NY-CO-8 antibody
STJ94581	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to NY-CO-8.

Anti-NY-CO-9 antibody
STJ94582	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to NY-CO-9.

CO-1686 (Rociletinib)
2794-25	Biovision		EUR 675

CO-1686 (Rociletinib)
2794-5	Biovision		EUR 207

Co 101244 hydrochloride
B7062-10	ApexBio	10 mg	EUR 334

Co 101244 hydrochloride
B7062-50	ApexBio	50 mg	EUR 1243

Co-Precipitant, Pink
BIO-37075	Bioline	1.5ml, 5mg/ml	Ask for price

Tetrodotoxin (TTX) ELISA Test Kit
DEIANJ48	Creative Diagnostics	96T	EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Melamine (MEL) Rapid Test Kit
abx092057-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit
abx092058-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit
abx092059-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit
abx092060-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit
abx092063-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Sulfonamides (Sas) Rapid Test Kit
abx092064-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit
abx092065-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Ciprofloxacin (CPFX) Rapid Test Kit
abx092066-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit
abx092067-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

PCRAgH5 AIV Detection Test Kit
PD55-02	Bionote	1 kit	EUR 902.47
Description: Please check the datasheet of PCRAgH5 AIV Detection Test Kit before using the test.

Rapid Leishmania Ab Test Kit
RB2104	Bionote	1 box	EUR 127
Description: Please check the datasheet of Rapid Leishmania Ab Test Kit before using the test.

Rapid PED Ag Test Kit
RG14-01	Bionote	1 box	EUR 159.9
Description: Please check the datasheet of Rapid PED Ag Test Kit before using the test.

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg	EnQuireBio	1mg	EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg	EnQuireBio	1mg	EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug	EnQuireBio	20ug	EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug	EnQuireBio	5ug	EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug	EnQuireBio	500ug	EUR 663

SARS-CoV spike protein Antibody
abx023139-100ug	Abbexa	100 ug	EUR 857
Shipped within 5-10 working days.

SARS-CoV spike protein Antibody
abx023143-100ug	Abbexa	100 ug	EUR 857
Shipped within 5-10 working days.

SARS Polyclonal Antibody, HRP Conjugated
A53978	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SARS Polyclonal Antibody, FITC Conjugated
A53979	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SARS Polyclonal Antibody, Biotin Conjugated
A53980	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SARS-CoV-2 IgG ELISA Kit 1-plate EUA
K075-H1	Arbor Assays	1-plate	EUR 552
Description: This K075-H1 SARS-CoV-2 IgG ELISA Kit 1-plate EUA is only for certified clinical lab use only. The assay has been submitted for Emergency Use Authorization (EUA) through the US FDA. It has not been approved at the current time.

SARS-CoV-2 IgG ELISA Kit 5-plate EUA
K075-H5	Arbor Assays	5-plate	EUR 2054
Description: This K075-H5 SARS-CoV-2 IgG ELISA Kit 5-plate EUA is only for certified clinical lab use only. The assay has been submitted for Emergency Use Authorization (EUA) through the US FDA. It has not been approved at the current time.

Lipoprotein-associated phospholipase A2 (Up-converting Phosphor Technology)
abx095250-80Units	Abbexa	80 Units	EUR 1553
Shipped within 5-14 working days.

Cardiac Troponin I (cTnI) (Up-converting Phosphor Technology)
abx095252-80Units	Abbexa	80 Units	EUR 1316
Shipped within 5-14 working days.

SARS Rabbit pAb
A13350-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A13350-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A13350-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A13350-50ul	Abclonal	50 ul	EUR 223

SARS Blocking Peptide
33R-8713	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide
33R-7048	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS S1 [His]
DAG1861	Creative Diagnostics	500 ug	EUR 2529

SARS S2 [His]
DAG1862	Creative Diagnostics	500 ug	EUR 2529

SARS cloning plasmid
CSB-CL020709HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb
A6733-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A6733-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A6733-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A6733-50ul	Abclonal	50 ul	EUR 223

SARS Protease Substrate
H-5982.0500	Bachem	0.5mg	EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000	Bachem	1.0mg	EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS (1H4)
YF-MA10816	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SARS

Influenza A Virus H1N1 Beijing 262/95
7-07924	CHI Scientific	10µg	Ask for price

Influenza A Virus H1N1 Beijing 262/95
7-07925	CHI Scientific	50µg	Ask for price

Influenza A Virus H1N1 Beijing 262/95
7-07926	CHI Scientific	1mg	Ask for price

Influenza A Virus (H1N1) Beijing 262/95
RP-1520	Alpha Diagnostics	10 ug	EUR 225

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

HAV antibody IgM ELISA test
75	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HAV antibody IgM

HEV antibody IgM ELISA test
92	Biobase	96T/Box	Ask for price
Area of application: Hepatitis testing
Description: ELISA based test for quantitative detection of HEV antibody IgM

Porcine Circovirus 2 Antibodies Rapid Test Kit (Colloidal gold)
abx092027-40tests	Abbexa	40 tests	EUR 321
Shipped within 5-12 working days.