Sars Stool Test Kit

Lab Reagents

Human IgG antibody Laboratories manufactures the sars stool test kit reagents distributed by Genprice. The Sars Stool Test Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Kit. Other Sars products are available in stock. Specificity: Sars Category: Stool Group: Test Kit

Test Kit information

SARS antibody
70R-1444	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody
70R-1445	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody
39139-100ul	SAB	100ul	EUR 252

SARS Antibody
1-CSB-PA04145A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody
1-CSB-PA020709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA
20-abx904776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932473	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SARS siRNA
20-abx932474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223-SARS
PVT12269	Lifescience Market	2 ug	EUR 391

Melamine Rapid Test Kit
abx092011-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

NDV rapid test kit
RG15-03	Bionote	1 box	EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

NATtrol Rotavirus (Stool Matrix) (0.5 mL)
NATROTA-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Rotavirus Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-20tests	Accu test	20 tests	EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test
GEN-B352-40tests	Accu test	40 tests	EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SARS Coronavirus IgG ELISA Kit
DEIA1035	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit
DEIA1036	Creative Diagnostics	96T	EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS CoV-2 PCR kit
PCR-H731-48R	Bioingentech	48T	EUR 823

SARS CoV-2 PCR kit
PCR-H731-96R	Bioingentech	96T	EUR 1113

Tetrodotoxin (TTX) ELISA Test Kit
DEIANJ48	Creative Diagnostics	96T	EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Melamine (MEL) Rapid Test Kit
abx092057-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit
abx092058-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit
abx092059-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit
abx092060-50tests	Abbexa	50 tests	EUR 244
Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit
abx092063-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Sulfonamides (Sas) Rapid Test Kit
abx092064-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit
abx092065-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Ciprofloxacin (CPFX) Rapid Test Kit
abx092066-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit
abx092067-40tests	Abbexa	40 tests	EUR 398
Shipped within 5-12 working days.

Brucella Antibody Rapid Test Kit
abx092069-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

PCRAgH5 AIV Detection Test Kit
PD55-02	Bionote	1 kit	EUR 902.47
Description: Please check the datasheet of PCRAgH5 AIV Detection Test Kit before using the test.

Rapid Leishmania Ab Test Kit
RB2104	Bionote	1 box	EUR 127
Description: Please check the datasheet of Rapid Leishmania Ab Test Kit before using the test.

Rapid PED Ag Test Kit
RG14-01	Bionote	1 box	EUR 159.9
Description: Please check the datasheet of Rapid PED Ag Test Kit before using the test.

Antibody ISOTYPING TEST KIT (OKSA11303)
OKSA11303	Aviva Systems Biology	10 Tests	EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP13416-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP13416-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP13416-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug
QP13417-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg
QP13417-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug
QP13417-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug
QP13418-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg
QP13418-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug
QP13418-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug
QP13419-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg
QP13419-1mg	EnQuireBio	1mg	EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug
QP13419-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg
QP13423-1mg	EnQuireBio	1mg	EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug
QP13423-20ug	EnQuireBio	20ug	EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug
QP13423-5ug	EnQuireBio	5ug	EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug
QP10499-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg
QP10499-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug
QP10499-500ug	EnQuireBio	500ug	EUR 663

NATtrol Clostridium difficile (Stool Matrix) (0.5 mL)
NATCDI-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Clostridium difficile Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Campylobacter jejuni (Stool Matrix) (0.5 mL)
NATCJE-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Campylobacter jejuni Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Escherichia coli (Stool Matrix) (0.5 mL)
NATECO(933)-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Escherichia coli Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Escherichia coli (Stool Matrix) (0.5 mL)
NATECO(ETEC)-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Escherichia coli Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Entamoeba histolytica (Stool Matrix) (0.5 mL)
NATEHI(DS4)-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Entamoeba histolytica Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Shigella sonnei (Stool Matrix) (0.5 mL)
NATSSO-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Shigella sonnei Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Salmonella typhimurium (Stool Matrix) (0.5 mL)
NATSTY-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Salmonella typhimurium Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SARS Spike Antibody
24216-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24217-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24218-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24219-100ul	SAB	100ul	EUR 390

SARS Spike Antibody
24318-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24319-100ul	SAB	100ul	EUR 390

SARS Matrix Antibody
24320-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24321-100ul	SAB	100ul	EUR 390

SARS Envelope Antibody
24322-100ul	SAB	100ul	EUR 390

SARS Rabbit pAb
A13350-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A13350-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A13350-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A13350-50ul	Abclonal	50 ul	EUR 223

SARS Blocking Peptide
33R-8713	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide
33R-7048	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody
10R-1976	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody
10R-1977	Fitzgerald	100 ul	EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody
10C-CR9003M1	Fitzgerald	100 ug	EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody
10R-10470	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody
10R-10471	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]
DAG1861	Creative Diagnostics	500 ug	EUR 2529

SARS S2 [His]
DAG1862	Creative Diagnostics	500 ug	EUR 2529

SARS-E2 Antibody
abx016055-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS-M Antibody
abx016056-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137184	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1720.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137185	Abbexa	EUR 1052.00 EUR 1539.00 EUR 1970.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Spike Antibody
20-abx137200	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Nucleocapsid Antibody
20-abx137201	Abbexa	EUR 1177.00 EUR 1887.00 EUR 2221.00	100 ug 200 ug 300 µg
Shipped within 5-10 working days.

SARS Conjugated Antibody
C39139	SAB	100ul	EUR 397

SARS cloning plasmid
CSB-CL020709HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid
CSB-CL020709HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1545 Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb
A6733-100ul	Abclonal	100 ul	EUR 308

SARS Rabbit pAb
A6733-200ul	Abclonal	200 ul	EUR 459

SARS Rabbit pAb
A6733-20ul	Abclonal	20 ul	EUR 183

SARS Rabbit pAb
A6733-50ul	Abclonal	50 ul	EUR 223

SARS Polyclonal Antibody
A53977	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate
H-5982.0500	Bachem	0.5mg	EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate
H-5982.1000	Bachem	1.0mg	EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody
PAab07609	Lifescience Market	100 ug	EUR 386

Anti-SARS antibody
STJ28816	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody
STJ115313	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)
YF-MA10816	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SARS

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

DNASE TEST AGAR
D04-101-10kg	Alphabiosciences	10 kg	Ask for price

DNASE TEST AGAR
D04-101-2Kg	Alphabiosciences	2 Kg	Ask for price

DNASE TEST AGAR
D04-101-500g	Alphabiosciences	500 g	Ask for price

DERMATOPHYTE TEST AGAR
D04-107-10kg	Alphabiosciences	10 kg	EUR 849

DERMATOPHYTE TEST AGAR
D04-107-2Kg	Alphabiosciences	2 Kg	EUR 224

DERMATOPHYTE TEST AGAR
D04-107-500g	Alphabiosciences	500 g	EUR 97

MOTILITY TEST MEDIUM
M13-121-10kg	Alphabiosciences	10 kg	EUR 1528

MOTILITY TEST MEDIUM
M13-121-2Kg	Alphabiosciences	2 Kg	EUR 371

MOTILITY TEST MEDIUM
M13-121-500g	Alphabiosciences	500 g	EUR 137

SNYDER TEST AGAR
S19-119-10kg	Alphabiosciences	10 kg	EUR 1049

SNYDER TEST AGAR
S19-119-2Kg	Alphabiosciences	2 Kg	EUR 267

SNYDER TEST AGAR
S19-119-500g	Alphabiosciences	500 g	EUR 109

SAM Test Strip
TS00201s-30	Arthus	30 tests	EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip
TS00301s-30	Arthus	30 tests	EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip
TS00401s-30	Arthus	30 tests	EUR 553
Description: Serum homocysteine quantitative test strip

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Stool DNA Isolation Mini Kit (50prep), with Proteinase K Powder
FASTI001	Favorgen	50 preps	EUR 165

Stool DNA Isolation Mini Kit (100prep), with Proteinase K Powder
FASTI001-1	Favorgen	100 preps	EUR 218

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)
GEN-402-25tests	All test	25 tests	EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

SARS-CoV-2 Antigen ELISA Kit
DEIA2020	Creative Diagnostics	96 tests	EUR 905
The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit
E4901-100	Biovision	100 assays	EUR 753

SARS CoV-2 RT PCR kit
RTq-H731-100R	Bioingentech	100T	EUR 1311

SARS CoV-2 RT PCR kit
RTq-H731-150R	Bioingentech	150T	EUR 1787

SARS CoV-2 RT PCR kit
RTq-H731-50R	Bioingentech	50T	EUR 963

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

NATtrol Adenovirus Type 40 (Stool Matrix) (0.5 mL)
NATADV40-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Adenovirus Type 40 Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Adenovirus Type 41 (Stool Matrix) (0.5 mL)
NATADV41-GP	Zeptometrix	0.5 mL	EUR 93.68
What is the product classification? NATtrol Adenovirus Type 41 Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Clenbuterol Rapid Test Kit (Colloidal gold)
abx092040-50tests	Abbexa	50 tests	EUR 272
Shipped within 5-12 working days.

Ractopamine Rapid Test Kit (Colloidal gold)
abx092042-50tests	Abbexa	50 tests	EUR 300
Shipped within 5-12 working days.

Salbutamol Rapid Test Kit (Colloidal gold)
abx092043-50tests	Abbexa	50 tests	EUR 342
Shipped within 5-12 working days.

Chloramphenicol Rapid Test Kit (Colloidal gold)
abx092045-50tests	Abbexa	50 tests	EUR 356
Shipped within 5-12 working days.

Quinolones Rapid Test Kit (Colloidal gold)
abx092046-50tests	Abbexa	50 tests	EUR 537
Shipped within 5-12 working days.

Sulfonamides Rapid Test Kit (Colloidal gold)
abx092047-50tests	Abbexa	50 tests	EUR 551
Shipped within 5-12 working days.

Tetracycline Rapid Test Kit (Colloidal gold)
abx092048-50tests	Abbexa	50 tests	EUR 467
Shipped within 5-12 working days.

Zearalenone Rapid Test Kit (Colloidal gold)
abx092051-50tests	Abbexa	50 tests	EUR 411
Shipped within 5-12 working days.

Deoxynivalenol Rapid Test Kit (Colloidal gold)
abx092052-50tests	Abbexa	50 tests	EUR 467
Shipped within 5-12 working days.

Deoxynivalenol Rapid Test Kit (Colloidal gold)
abx092053-50tests	Abbexa	50 tests	EUR 467
Shipped within 5-12 working days.

Aflatoxin Rapid Test Kit (Colloidal gold)
abx092054-50tests	Abbexa	50 tests	EUR 398
Shipped within 5-12 working days.

Zearalenone Rapid Test Kit (Colloidal gold)
abx092056-50tests	Abbexa	50 tests	EUR 425
Shipped within 5-12 working days.

Goat Brucella Antibody Rapid Test Kit
abx092070-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Cow Brucella Antibody Rapid Test Kit
abx092071-40tests	Abbexa	40 tests	EUR 356
Shipped within 5-12 working days.

Pig Parvovirus Antibody Rapid Test Kit
abx092074-50tests	Abbexa	50 tests	EUR 321
Shipped within 5-12 working days.

Anigen Rapid FIV Ab Test Kit
RB22-01-DD	Bionote	10 tests/Kit	EUR 129.8
Description: Please check the datasheet of Anigen Rapid FIV Ab Test Kit before using the test.

Rapid Bovine Brucella Ab Test Kit
RB23-01-DD	Bionote	1 kit/10 tests	EUR 151.79
Description: Please check the datasheet of Rapid Bovine Brucella Ab Test Kit before using the test.

Rapid Bovine TB Ab Test Kit
RB23-02-DD	Bionote	1 box	EUR 128.4
Description: Please check the datasheet of Rapid Bovine TB Ab Test Kit before using the test.

Rapid FMD NSP Ab Test Kit
RB28-02-DD	Bionote	1 box	EUR 135.4
Description: Please check the datasheet of Rapid FMD NSP Ab Test Kit before using the test.

AgRapidFeLV Ag/FIV Ab Test Kit
RC12-04	Bionote	10 tests/kit	EUR 170.4
Description: Please check the datasheet of AgRapidFeLV Ag/FIV Ab Test Kit before using the test.

Ag rapid CDV Ag Test Kit
RG11-03	Bionote	1 box	EUR 138.2
Description: Please check the datasheet of Ag rapid CDV Ag Test Kit before using the test.

Rapid TGE/PED Ag Test Kit
RG14-03	Bionote	1 box	EUR 240.85
Description: Please check the datasheet of Rapid TGE/PED Ag Test Kit before using the test.

Ag Rapid AIV Ag Test Kit
RG15-01	Bionote	1 box/30 tests	EUR 267
Description: Please check the datasheet of Ag Rapid AIV Ag Test Kit before using the test.

Ag Rapid H5AIV Ag test kit
RG15-05	Bionote	1 box	EUR 463
Description: Please check the datasheet of Ag Rapid H5AIV Ag test kit before using the test.

Rat Antibody ISOTYPING TEST KIT (OKSA11304)
OKSA11304	Aviva Systems Biology	10 Tests	EUR 924
Description: Description of target: RAT MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Rat;Application: IS;Assay info: ;Sensitivity:

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug
QP13420-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg
QP13420-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug
QP13420-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug
QP13421-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg
QP13421-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug
QP13421-500ug	EnQuireBio	500ug	EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug
QP13422-100ug	EnQuireBio	100ug	EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg
QP13422-1mg	EnQuireBio	1mg	EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug
QP13422-500ug	EnQuireBio	500ug	EUR 663

Polyclonal SARS Matrix Antibody
APG02976G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated
1-CSB-PA04145B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated
1-CSB-PA04145C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated
1-CSB-PA04145D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)
80R-2099	Fitzgerald	50 ug	EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody
abx018255-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS N Protein Antibody
abx018256-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

SARS virus Sn Antibody
abx032683-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.