Sars Stool Test Kit

Lab Reagents

Human IgG antibody Laboratories manufactures the sars stool test kit reagents distributed by Genprice. The Sars Stool Test Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Kit. Other Sars products are available in stock. Specificity: Sars Category: Stool Group: Test Kit

Test Kit information

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Melamine Rapid Test Kit

abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

NDV rapid test kit

RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

NATtrol Rotavirus (Stool Matrix) (0.5 mL)

NATROTA-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Rotavirus Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

SARS Coronavirus IgG ELISA Kit

DEIA1035 96T
EUR 2159
Description: For the qualitative determination of IgG class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS Coronavirus IgM ELISA Kit

DEIA1036 96T
EUR 2159
Description: For the qualitative determination of IgM class antibodies against SARS Coronavirus in Human serum or plasma. It is intended for diagnosing and monitoring of patients related to infection by SARS Coronavirus.

SARS CoV-2 PCR kit

PCR-H731-48R 48T
EUR 823

SARS CoV-2 PCR kit

PCR-H731-96R 96T
EUR 1113

Tetrodotoxin (TTX) ELISA Test Kit

DEIANJ48 96T
EUR 1625
Description: This test kit is for the quantitative detection of Tetrodotoxin in the tissue, liver, fish.

Melamine (MEL) Rapid Test Kit

abx092057-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

Clenbuterol (CLE) Rapid Test Kit

abx092058-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Ractopamine (RAC) Rapid Test Kit

abx092059-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Salbutamol (SAL) Rapid Test Kit

abx092060-50tests 50 tests
EUR 244
  • Shipped within 5-12 working days.

Tetracycline (TCs) Rapid Test Kit

abx092063-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Sulfonamides (Sas) Rapid Test Kit

abx092064-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit

abx092065-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Ciprofloxacin (CPFX) Rapid Test Kit

abx092066-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Quinolones (QNs) Rapid Test Kit

abx092067-40tests 40 tests
EUR 398
  • Shipped within 5-12 working days.

Brucella Antibody Rapid Test Kit

abx092069-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

PCRAgH5 AIV Detection Test Kit

PD55-02 1 kit
EUR 902.47
Description: Please check the datasheet of PCRAgH5 AIV Detection Test Kit before using the test.

Rapid Leishmania Ab Test Kit

RB2104 1 box
EUR 127
Description: Please check the datasheet of Rapid Leishmania Ab Test Kit before using the test.

Rapid PED Ag Test Kit

RG14-01 1 box
EUR 159.9
Description: Please check the datasheet of Rapid PED Ag Test Kit before using the test.

Antibody ISOTYPING TEST KIT (OKSA11303)

OKSA11303 10 Tests
EUR 780
Description: Description of target: MOUSE MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Mouse;Application: IS;Assay info: ;Sensitivity:

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

NATtrol Clostridium difficile (Stool Matrix) (0.5 mL)

NATCDI-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Clostridium difficile Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Campylobacter jejuni (Stool Matrix) (0.5 mL)

NATCJE-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Campylobacter jejuni Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Escherichia coli (Stool Matrix) (0.5 mL)

NATECO(933)-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Escherichia coli Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Escherichia coli (Stool Matrix) (0.5 mL)

NATECO(ETEC)-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Escherichia coli Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Entamoeba histolytica (Stool Matrix) (0.5 mL)

NATEHI(DS4)-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Entamoeba histolytica Stool Matrix) is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Shigella sonnei (Stool Matrix) (0.5 mL)

NATSSO-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Shigella sonnei Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Salmonella typhimurium (Stool Matrix) (0.5 mL)

NATSTY-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Salmonella typhimurium Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Anti-SARS antibody

PAab07609 100 ug
EUR 386

Anti-SARS antibody

STJ28816 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS antibody

STJ115313 100 µl
EUR 277
Description: This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown.

Anti-SARS (1H4)

YF-MA10816 100 ug
EUR 363
Description: Mouse monoclonal to SARS

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

DNASE TEST AGAR

D04-101-10kg 10 kg Ask for price

DNASE TEST AGAR

D04-101-2Kg 2 Kg Ask for price

DNASE TEST AGAR

D04-101-500g 500 g Ask for price

DERMATOPHYTE TEST AGAR

D04-107-10kg 10 kg
EUR 849

DERMATOPHYTE TEST AGAR

D04-107-2Kg 2 Kg
EUR 224

DERMATOPHYTE TEST AGAR

D04-107-500g 500 g
EUR 97

MOTILITY TEST MEDIUM

M13-121-10kg 10 kg
EUR 1528

MOTILITY TEST MEDIUM

M13-121-2Kg 2 Kg
EUR 371

MOTILITY TEST MEDIUM

M13-121-500g 500 g
EUR 137

SNYDER TEST AGAR

S19-119-10kg 10 kg
EUR 1049

SNYDER TEST AGAR

S19-119-2Kg 2 Kg
EUR 267

SNYDER TEST AGAR

S19-119-500g 500 g
EUR 109

SAM Test Strip

TS00201s-30 30 tests
EUR 416
Description: S-adenosylmethionine quantitative test strip for serum, plasma and whole blood

SAH Test Strip

TS00301s-30 30 tests
EUR 504
Description: S-adenosylhomocysteine quantitative test strip for serum, plasma and whole blood

HCY Test Strip

TS00401s-30 30 tests
EUR 553
Description: Serum homocysteine quantitative test strip

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Stool DNA Isolation Mini Kit (50prep), with Proteinase K Powder

FASTI001 50 preps
EUR 165

Stool DNA Isolation Mini Kit (100prep), with Proteinase K Powder

FASTI001-1 100 preps
EUR 218

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)

GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

SARS-CoV-2 Antigen ELISA Kit

DEIA2020 96 tests
EUR 905
  • The LOD of this kit is 1 ng/mL of SARS-COV-2 nucleoprotein.
Description: SARS-CoV-2 Antigen ELISA Kit intended use is for quantitative detection of the recombinant SARS-COV-2 nucleoprotein antigen in human serum. The use of this kit for natural samples need to be validated by the end user due to the complexity of natural targets and unpredictable interference.

SARS-CoV-2 IgG ELISA Kit

E4901-100 100 assays
EUR 753

SARS CoV-2 RT PCR kit

RTq-H731-100R 100T
EUR 1311

SARS CoV-2 RT PCR kit

RTq-H731-150R 150T
EUR 1787

SARS CoV-2 RT PCR kit

RTq-H731-50R 50T
EUR 963

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

NATtrol Adenovirus Type 40 (Stool Matrix) (0.5 mL)

NATADV40-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Adenovirus Type 40 Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Adenovirus Type 41 (Stool Matrix) (0.5 mL)

NATADV41-GP 0.5 mL
EUR 93.68
  • What is the product classification?
  • NATtrol Adenovirus Type 41 Stool Matrix is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Clenbuterol Rapid Test Kit (Colloidal gold)

abx092040-50tests 50 tests
EUR 272
  • Shipped within 5-12 working days.

Ractopamine Rapid Test Kit (Colloidal gold)

abx092042-50tests 50 tests
EUR 300
  • Shipped within 5-12 working days.

Salbutamol Rapid Test Kit (Colloidal gold)

abx092043-50tests 50 tests
EUR 342
  • Shipped within 5-12 working days.

Chloramphenicol Rapid Test Kit (Colloidal gold)

abx092045-50tests 50 tests
EUR 356
  • Shipped within 5-12 working days.

Quinolones Rapid Test Kit (Colloidal gold)

abx092046-50tests 50 tests
EUR 537
  • Shipped within 5-12 working days.

Sulfonamides Rapid Test Kit (Colloidal gold)

abx092047-50tests 50 tests
EUR 551
  • Shipped within 5-12 working days.

Tetracycline Rapid Test Kit (Colloidal gold)

abx092048-50tests 50 tests
EUR 467
  • Shipped within 5-12 working days.

Zearalenone Rapid Test Kit (Colloidal gold)

abx092051-50tests 50 tests
EUR 411
  • Shipped within 5-12 working days.

Deoxynivalenol Rapid Test Kit (Colloidal gold)

abx092052-50tests 50 tests
EUR 467
  • Shipped within 5-12 working days.

Deoxynivalenol Rapid Test Kit (Colloidal gold)

abx092053-50tests 50 tests
EUR 467
  • Shipped within 5-12 working days.

Aflatoxin Rapid Test Kit (Colloidal gold)

abx092054-50tests 50 tests
EUR 398
  • Shipped within 5-12 working days.

Zearalenone Rapid Test Kit (Colloidal gold)

abx092056-50tests 50 tests
EUR 425
  • Shipped within 5-12 working days.

Goat Brucella Antibody Rapid Test Kit

abx092070-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

Cow Brucella Antibody Rapid Test Kit

abx092071-40tests 40 tests
EUR 356
  • Shipped within 5-12 working days.

Pig Parvovirus Antibody Rapid Test Kit

abx092074-50tests 50 tests
EUR 321
  • Shipped within 5-12 working days.

Anigen Rapid FIV Ab Test Kit

RB22-01-DD 10 tests/Kit
EUR 129.8
Description: Please check the datasheet of Anigen Rapid FIV Ab Test Kit before using the test.

Rapid Bovine Brucella Ab Test Kit

RB23-01-DD 1 kit/10 tests
EUR 151.79
Description: Please check the datasheet of Rapid Bovine Brucella Ab Test Kit before using the test.

Rapid Bovine TB Ab Test Kit

RB23-02-DD 1 box
EUR 128.4
Description: Please check the datasheet of Rapid Bovine TB Ab Test Kit before using the test.

Rapid FMD NSP Ab Test Kit

RB28-02-DD 1 box
EUR 135.4
Description: Please check the datasheet of Rapid FMD NSP Ab Test Kit before using the test.

AgRapidFeLV Ag/FIV Ab Test Kit

RC12-04 10 tests/kit
EUR 170.4
Description: Please check the datasheet of AgRapidFeLV Ag/FIV Ab Test Kit before using the test.

Ag rapid CDV Ag Test Kit

RG11-03 1 box
EUR 138.2
Description: Please check the datasheet of Ag rapid CDV Ag Test Kit before using the test.

Rapid TGE/PED Ag Test Kit

RG14-03 1 box
EUR 240.85
Description: Please check the datasheet of Rapid TGE/PED Ag Test Kit before using the test.

Ag Rapid AIV Ag Test Kit

RG15-01 1 box/30 tests
EUR 267
Description: Please check the datasheet of Ag Rapid AIV Ag Test Kit before using the test.

Ag Rapid H5AIV Ag test kit

RG15-05 1 box
EUR 463
Description: Please check the datasheet of Ag Rapid H5AIV Ag test kit before using the test.

Rat Antibody ISOTYPING TEST KIT (OKSA11304)

OKSA11304 10 Tests
EUR 924
Description: Description of target: RAT MONOCLONAL ANTIBODY ISOTYPING TEST KIT;Species reactivity: Rat;Application: IS;Assay info: ;Sensitivity:

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)

80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.